Transcript: Mouse NM_133884.2

Mus musculus GPN-loop GTPase 2 (Gpn2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Mus musculus (mouse)
Gene:
Gpn2 (100210)
Length:
1356
CDS:
87..1019

Additional Resources:

NCBI RefSeq record:
NM_133884.2
NBCI Gene record:
Gpn2 (100210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250845 ACCATGCTGCACGTGGAATTG pLKO_005 579 CDS 100% 10.800 15.120 N Gpn2 n/a
2 TRCN0000194347 CATCCCTGCAAAGGACTTCTA pLKO.1 1108 3UTR 100% 4.950 3.960 N Gpn2 n/a
3 TRCN0000250842 TCTCCAAGATGGACCTTATTG pLKO_005 616 CDS 100% 13.200 9.240 N Gpn2 n/a
4 TRCN0000258089 ACAGCATCCAGCGAGTCTTAC pLKO_005 823 CDS 100% 10.800 7.560 N Gpn2 n/a
5 TRCN0000217146 CAGGCTGTGGATAAAGCTAAT pLKO.1 843 CDS 100% 10.800 7.560 N Gpn2 n/a
6 TRCN0000250843 GCATCCAGGAGAAGTACTTAG pLKO_005 955 CDS 100% 10.800 7.560 N Gpn2 n/a
7 TRCN0000250844 TAGAGAAGAAGCCACGCATAG pLKO_005 1127 3UTR 100% 6.000 4.200 N Gpn2 n/a
8 TRCN0000174732 GATGGACCTTATTGAACACTA pLKO.1 623 CDS 100% 4.950 3.465 N Gpn2 n/a
9 TRCN0000377283 GCCTTCAACCTGGACTACTAC pLKO_005 654 CDS 100% 4.950 3.465 N GPN2 n/a
10 TRCN0000173180 CTAGAGAAGAAGCCACGCATA pLKO.1 1126 3UTR 100% 4.050 2.835 N Gpn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08405 pDONR223 100% 91% 96.4% None (many diffs) n/a
2 ccsbBroad304_08405 pLX_304 0% 91% 96.4% V5 (many diffs) n/a
3 TRCN0000469781 ATTATCCAAACTTGCCTTACTGTA pLX_317 39% 91% 96.4% V5 (many diffs) n/a
4 TRCN0000489829 GTTAATTGCGCAACGATCCTCGGG pLX_317 38.2% 91% 96.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_08404 pDONR223 100% 90.8% 96.1% None (many diffs) n/a
6 ccsbBroad304_08404 pLX_304 0% 90.8% 96.1% V5 (many diffs) n/a
7 TRCN0000470977 GAATTCTATGATTGAAGTACACAC pLX_317 43.6% 90.8% 96.1% V5 (many diffs) n/a
Download CSV