Transcript: Mouse NM_133915.3

Mus musculus paxillin (Pxn), transcript variant beta, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pxn (19303)
Length:
3824
CDS:
181..1956

Additional Resources:

NCBI RefSeq record:
NM_133915.3
NBCI Gene record:
Pxn (19303)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097197 CTACTCCTACCCAACTGGAAA pLKO.1 270 CDS 100% 4.950 6.930 N Pxn n/a
2 TRCN0000097195 TCTGAACTTGACCGGCTGTTA pLKO.1 607 CDS 100% 4.950 6.930 N Pxn n/a
3 TRCN0000308361 TCTGAACTTGACCGGCTGTTA pLKO_005 607 CDS 100% 4.950 6.930 N Pxn n/a
4 TRCN0000311221 ACGGACCCATCCTGGATAAAG pLKO_005 1442 CDS 100% 13.200 10.560 N Pxn n/a
5 TRCN0000305025 ACTAGACAATGCCAGCATAAA pLKO_005 2357 3UTR 100% 13.200 10.560 N Pxn n/a
6 TRCN0000097196 TCGTAAAGATTACTTCGACAT pLKO.1 1572 CDS 100% 4.050 3.240 N Pxn n/a
7 TRCN0000308432 TCGTAAAGATTACTTCGACAT pLKO_005 1572 CDS 100% 4.050 3.240 N Pxn n/a
8 TRCN0000123138 ACCCAACTGGAAACCACACAT pLKO.1 278 CDS 100% 4.950 3.465 N PXN n/a
9 TRCN0000286555 ACCCAACTGGAAACCACACAT pLKO_005 278 CDS 100% 4.950 3.465 N PXN n/a
10 TRCN0000123136 CCCAACTGGAAACCACACATA pLKO.1 279 CDS 100% 4.950 3.465 N PXN n/a
11 TRCN0000097194 GAACTACATTTCAGCCCTCAA pLKO.1 1635 CDS 100% 4.050 2.835 N Pxn n/a
12 TRCN0000308431 GAACTACATTTCAGCCCTCAA pLKO_005 1635 CDS 100% 4.050 2.835 N Pxn n/a
13 TRCN0000097198 CTTTAGATCAGTGGCAGCCTA pLKO.1 374 CDS 100% 2.640 1.848 N Pxn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06826 pDONR223 100% 84% 89.5% None (many diffs) n/a
2 ccsbBroad304_06826 pLX_304 0% 84% 89.5% V5 (many diffs) n/a
3 TRCN0000477826 GCCAGAAGTTGGATACTCGACTGT pLX_317 18.8% 84% 89.5% V5 (many diffs) n/a
Download CSV