Transcript: Mouse NM_134040.1

Mus musculus DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 (Ddx1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ddx1 (104721)
Length:
2488
CDS:
56..2278

Additional Resources:

NCBI RefSeq record:
NM_134040.1
NBCI Gene record:
Ddx1 (104721)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096852 CCCAGATAATTACATCGTCAA pLKO.1 838 CDS 100% 4.050 5.670 N Ddx1 n/a
2 TRCN0000305215 CCCAGGTCGAGCCAGATATAA pLKO_005 2067 CDS 100% 15.000 10.500 N Ddx1 n/a
3 TRCN0000305216 GATGTGGTCTGAAGCTATTAA pLKO_005 1504 CDS 100% 15.000 10.500 N Ddx1 n/a
4 TRCN0000305217 ACAACCAGATTCCGCAGATTA pLKO_005 1218 CDS 100% 13.200 9.240 N Ddx1 n/a
5 TRCN0000305272 CCGTGGGAAGGGATGCTATAA pLKO_005 1954 CDS 100% 13.200 9.240 N Ddx1 n/a
6 TRCN0000096851 CCATTGGATGTTACTTAGATA pLKO.1 627 CDS 100% 5.625 3.938 N Ddx1 n/a
7 TRCN0000096849 CAGAGGAGCATTGGAGTCATA pLKO.1 2290 3UTR 100% 4.950 3.465 N Ddx1 n/a
8 TRCN0000309156 CAGAGGAGCATTGGAGTCATA pLKO_005 2290 3UTR 100% 4.950 3.465 N Ddx1 n/a
9 TRCN0000096853 GAAGTTCTCTAAGAATGGAAA pLKO.1 664 CDS 100% 4.950 3.465 N Ddx1 n/a
10 TRCN0000096850 CCAGGCAGAATCTATCCCATT pLKO.1 139 CDS 100% 4.050 2.835 N Ddx1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06091 pDONR223 100% 90.1% 97.5% None (many diffs) n/a
2 ccsbBroad304_06091 pLX_304 0% 90.1% 97.5% V5 (many diffs) n/a
3 TRCN0000472468 AAGTGACTTATGCTACTACCCCAA pLX_317 21.8% 90.1% 97.5% V5 (many diffs) n/a
4 ccsbBroadEn_10772 pDONR223 100% 84.8% 91.7% None (many diffs) n/a
Download CSV