Transcript: Mouse NM_134156.2

Mus musculus actinin, alpha 1 (Actn1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Actn1 (109711)
Length:
3739
CDS:
281..2959

Additional Resources:

NCBI RefSeq record:
NM_134156.2
NBCI Gene record:
Actn1 (109711)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330526 ATTAACTATTTGCACCGAAAT pLKO_005 3295 3UTR 100% 10.800 15.120 N ACTN1 n/a
2 TRCN0000330527 TCACGCCTCAGGAGATCAATG pLKO_005 2064 CDS 100% 10.800 7.560 N ACTN1 n/a
3 TRCN0000090178 CCACAAAGTGACAGTTTACAA pLKO.1 3126 3UTR 100% 5.625 3.938 N Actn1 n/a
4 TRCN0000090182 GCCCGAATCATGAGCATTGTA pLKO.1 2657 CDS 100% 5.625 3.938 N Actn1 n/a
5 TRCN0000055823 CCTCAGGAGATCAATGGCAAA pLKO.1 2069 CDS 100% 4.050 2.835 N ACTN1 n/a
6 TRCN0000090181 CCGAGTTGATTGACTATGGAA pLKO.1 843 CDS 100% 3.000 2.100 N Actn1 n/a
7 TRCN0000090180 GCATCGTCAATTACAAGCCAA pLKO.1 2310 CDS 100% 2.640 1.848 N Actn1 n/a
8 TRCN0000090179 CCAGGAACAGATGAACGAATT pLKO.1 2512 CDS 100% 0.000 0.000 N Actn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134156.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00016 pDONR223 100% 79.6% 83.9% None (many diffs) n/a
2 ccsbBroad304_00016 pLX_304 0% 79.6% 83.9% V5 (many diffs) n/a
3 TRCN0000478445 AACAATATTTTCATGGGGTGCCTC pLX_317 12.7% 79.6% 83.9% V5 (many diffs) n/a
Download CSV