Transcript: Mouse NM_134160.1

Mus musculus mucolipin 3 (Mcoln3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mcoln3 (171166)
Length:
1712
CDS:
3..1664

Additional Resources:

NCBI RefSeq record:
NM_134160.1
NBCI Gene record:
Mcoln3 (171166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102905 GCGAAGTACAATCTCCTTATT pLKO.1 1188 CDS 100% 13.200 18.480 N Mcoln3 n/a
2 TRCN0000102907 CGCTGATAAACGGAGACGATA pLKO.1 1360 CDS 100% 4.950 6.930 N Mcoln3 n/a
3 TRCN0000102908 GACTATAACATTCGACAACAA pLKO.1 731 CDS 100% 4.950 6.930 N Mcoln3 n/a
4 TRCN0000102906 GCTGACTATAACATTCGACAA pLKO.1 728 CDS 100% 4.050 5.670 N Mcoln3 n/a
5 TRCN0000102909 GCTATGATCTATCTAGGCTAT pLKO.1 1260 CDS 100% 4.050 2.835 N Mcoln3 n/a
6 TRCN0000074311 CCATGGAAACTTGCCATACAA pLKO.1 180 CDS 100% 5.625 3.938 N MCOLN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134160.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12197 pDONR223 100% 48.7% 50.2% None (many diffs) n/a
2 ccsbBroad304_12197 pLX_304 0% 48.7% 50.2% V5 (many diffs) n/a
3 TRCN0000478835 GCCATGTGATAGAGAATTGTTCGG pLX_317 45.7% 48.7% 50.2% V5 (many diffs) n/a
Download CSV