Transcript: Mouse NM_134164.5

Mus musculus synaptotagmin XII (Syt12), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Syt12 (171180)
Length:
3277
CDS:
233..1498

Additional Resources:

NCBI RefSeq record:
NM_134164.5
NBCI Gene record:
Syt12 (171180)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134164.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379730 ACCAGACTGACCTACTGTATT pLKO_005 1748 3UTR 100% 13.200 18.480 N Syt12 n/a
2 TRCN0000382283 ATACTTGCAGGACCAGAATAA pLKO_005 1048 CDS 100% 13.200 18.480 N Syt12 n/a
3 TRCN0000382478 GTGGTGGCAAGGCTAATATTA pLKO_005 1891 3UTR 100% 15.000 10.500 N Syt12 n/a
4 TRCN0000381258 GATCCAGAGGAATGCCTATTC pLKO_005 853 CDS 100% 10.800 7.560 N Syt12 n/a
5 TRCN0000381450 GCAAAGGCAGCCTTAGTATAG pLKO_005 513 CDS 100% 10.800 7.560 N Syt12 n/a
6 TRCN0000093163 GTTGTGGTGAAAGCCAAGAAT pLKO.1 1139 CDS 100% 5.625 3.938 N Syt12 n/a
7 TRCN0000093161 CTTAGTATAGAAGACACCTTT pLKO.1 524 CDS 100% 4.950 3.465 N Syt12 n/a
8 TRCN0000379604 GTTCAACGAAGCCATGATCTT pLKO_005 1279 CDS 100% 4.950 3.465 N SYT12 n/a
9 TRCN0000093160 GCCTATTCCATCTTCTTCGAT pLKO.1 866 CDS 100% 3.000 2.100 N Syt12 n/a
10 TRCN0000093162 CCTTAGTATAGAAGACACCTT pLKO.1 523 CDS 100% 2.640 1.848 N Syt12 n/a
11 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 2756 3UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134164.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04554 pDONR223 100% 87.7% 95% None (many diffs) n/a
2 ccsbBroad304_04554 pLX_304 0% 87.7% 95% V5 (many diffs) n/a
3 TRCN0000472284 AACATCATACGTTCCGAATAGGCG pLX_317 24.4% 87.7% 95% V5 (many diffs) n/a
Download CSV