Transcript: Human NM_138453.4

Homo sapiens RAB3C, member RAS oncogene family (RAB3C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RAB3C (115827)
Length:
8861
CDS:
135..818

Additional Resources:

NCBI RefSeq record:
NM_138453.4
NBCI Gene record:
RAB3C (115827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138453.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379522 ATTACTCATCATCGGCAATAG pLKO_005 230 CDS 100% 10.800 15.120 N RAB3C n/a
2 TRCN0000379528 CATTTATACTGCCTAACAATT pLKO_005 895 3UTR 100% 13.200 9.240 N RAB3C n/a
3 TRCN0000381834 ACTCCTCTGATCAGAACTTTG pLKO_005 196 CDS 100% 10.800 7.560 N RAB3C n/a
4 TRCN0000380235 ATTTGAGCGCCTTGTGGATAT pLKO_005 683 CDS 100% 10.800 7.560 N RAB3C n/a
5 TRCN0000382295 CAACTGAGCGAGGTCAACATT pLKO_005 595 CDS 100% 5.625 3.938 N RAB3C n/a
6 TRCN0000029194 CCAGGAAAGATACAGGACTAT pLKO.1 398 CDS 100% 4.950 3.465 N RAB3C n/a
7 TRCN0000029197 CGTTATGCAGATGACTCCTTT pLKO.1 279 CDS 100% 4.950 3.465 N RAB3C n/a
8 TRCN0000029198 TCAGAGAGTTTGGAGACTGAT pLKO.1 720 CDS 100% 4.950 3.465 N RAB3C n/a
9 TRCN0000029196 CGAGGTCAACATTTAGGAGAA pLKO.1 603 CDS 100% 4.050 2.835 N RAB3C n/a
10 TRCN0000380524 AGAGAATCAAGCTTCAGATTT pLKO_005 364 CDS 100% 13.200 7.920 N RAB3C n/a
11 TRCN0000029195 CCTTCAATGCAGTACAAGATT pLKO.1 484 CDS 100% 5.625 3.375 N RAB3C n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3505 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138453.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478933 TTTATCGGTGCGTTTGGGGAAGTC pLX_317 55.4% 100% 100% V5 n/a
2 ccsbBroadEn_09423 pDONR223 100% 99.8% 99.5% None 669C>N n/a
3 ccsbBroad304_09423 pLX_304 0% 99.8% 99.5% V5 669C>N n/a
Download CSV