Transcript: Human NM_138457.3

Homo sapiens forkhead box P4 (FOXP4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
FOXP4 (116113)
Length:
5955
CDS:
504..2507

Additional Resources:

NCBI RefSeq record:
NM_138457.3
NBCI Gene record:
FOXP4 (116113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138457.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220226 GTTCGCCTATTTCCGCAGAAA pLKO.1 1964 CDS 100% 4.950 6.930 N FOXP4 n/a
2 TRCN0000220225 CCAGTTTATCAAACACCTCAA pLKO.1 1466 CDS 100% 4.050 3.240 N FOXP4 n/a
3 TRCN0000274894 CCAGTTTATCAAACACCTCAA pLKO_005 1466 CDS 100% 4.050 3.240 N FOXP4 n/a
4 TRCN0000220228 CACCAGGATGTTCGCCTATTT pLKO.1 1955 CDS 100% 13.200 9.240 N FOXP4 n/a
5 TRCN0000274834 CACCAGGATGTTCGCCTATTT pLKO_005 1955 CDS 100% 13.200 9.240 N FOXP4 n/a
6 TRCN0000285257 TGACCCTGAATGAGATCTATA pLKO_005 1927 CDS 100% 13.200 9.240 N FOXP4 n/a
7 TRCN0000274833 GTCTCTGCAGCAGACTCATTC pLKO_005 1656 CDS 100% 10.800 7.560 N FOXP4 n/a
8 TRCN0000220227 CCAGAATCATGAGTTCTACAA pLKO.1 1829 CDS 100% 4.950 3.465 N FOXP4 n/a
9 TRCN0000274832 CCAGAATCATGAGTTCTACAA pLKO_005 1829 CDS 100% 4.950 3.465 N FOXP4 n/a
10 TRCN0000220224 CCAGGGAACAATGACAGCAAA pLKO.1 762 CDS 100% 4.950 3.465 N FOXP4 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5304 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 5136 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5304 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138457.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467359 GCGGCTCATTGTCAACTTTCAGGT pLX_317 17.7% 99.7% 99.7% V5 21_23delGGAinsCCT;1244_1245delGCinsAA n/a
2 ccsbBroadEn_09429 pDONR223 100% 97.7% 97.7% None (many diffs) n/a
Download CSV