Transcript: Human NM_139126.4

Homo sapiens peptidylprolyl isomerase like 4 (PPIL4), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
PPIL4 (85313)
Length:
2475
CDS:
39..1517

Additional Resources:

NCBI RefSeq record:
NM_139126.4
NBCI Gene record:
PPIL4 (85313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139126.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229277 ACAGGATAAACCACCTAATTT pLKO_005 1064 CDS 100% 15.000 21.000 N PPIL4 n/a
2 TRCN0000229276 AGTCGGTTGCAAAGGTTAAAT pLKO_005 988 CDS 100% 15.000 21.000 N PPIL4 n/a
3 TRCN0000229274 ACCTACCTGATGCAGATATTA pLKO_005 724 CDS 100% 15.000 10.500 N PPIL4 n/a
4 TRCN0000219059 ATACAGATGTTGTCGACATTT pLKO_005 1872 3UTR 100% 13.200 9.240 N PPIL4 n/a
5 TRCN0000229275 CTCTAGATTTGGGCCAATAAG pLKO_005 818 CDS 100% 13.200 9.240 N PPIL4 n/a
6 TRCN0000049417 CCGAAGCAGAAGTCCAAAGAA pLKO.1 1463 CDS 100% 5.625 3.938 N PPIL4 n/a
7 TRCN0000049413 CCACCTAATTTGGTTCTGAAA pLKO.1 1074 CDS 100% 4.950 3.465 N PPIL4 n/a
8 TRCN0000049416 CCATCACTGTTCTGAAGAGAA pLKO.1 1205 CDS 100% 4.950 3.465 N PPIL4 n/a
9 TRCN0000049415 CCCAAGAATTAAGCACAAGAA pLKO.1 287 CDS 100% 4.950 3.465 N PPIL4 n/a
10 TRCN0000049414 GCAGATATTAAACCTCCAGAA pLKO.1 735 CDS 100% 4.050 2.835 N PPIL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139126.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04476 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04476 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480806 GGTATCATGTAGTCGGCATGCCTT pLX_317 29.1% 100% 100% V5 n/a
4 ccsbBroadEn_12908 pDONR223 100% 39% 39% None 1_900del n/a
5 ccsbBroad304_12908 pLX_304 0% 39% 39% V5 1_900del n/a
6 TRCN0000469721 CGGAATGTGGGCCCTCCCGAAACT pLX_317 12.2% 39% 39% V5 1_900del n/a
Download CSV