Transcript: Human NM_144563.3

Homo sapiens ribose 5-phosphate isomerase A (RPIA), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPIA (22934)
Length:
1813
CDS:
27..962

Additional Resources:

NCBI RefSeq record:
NM_144563.3
NBCI Gene record:
RPIA (22934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049408 CGGGTACACAAATGGAGTGAA pLKO.1 816 CDS 100% 4.950 6.930 N RPIA n/a
2 TRCN0000327830 CGGGTACACAAATGGAGTGAA pLKO_005 816 CDS 100% 4.950 6.930 N RPIA n/a
3 TRCN0000181790 GTCTACTTTGGGATGCAGGAT pLKO.1 906 CDS 100% 2.640 3.696 N Rpia n/a
4 TRCN0000328576 GTCTACTTTGGGATGCAGGAT pLKO_005 906 CDS 100% 2.640 3.696 N Rpia n/a
5 TRCN0000369927 GGGAGTTAAATCCAGTCTTAT pLKO_005 1099 3UTR 100% 13.200 9.240 N RPIA n/a
6 TRCN0000049411 GAAGTGAATACAGCTATCAAA pLKO.1 834 CDS 100% 5.625 3.938 N RPIA n/a
7 TRCN0000327831 GAAGTGAATACAGCTATCAAA pLKO_005 834 CDS 100% 5.625 3.938 N RPIA n/a
8 TRCN0000049410 GAATTGGAAGTGGTTCTACAA pLKO.1 328 CDS 100% 4.950 3.465 N RPIA n/a
9 TRCN0000363585 GAATTGGAAGTGGTTCTACAA pLKO_005 328 CDS 100% 4.950 3.465 N RPIA n/a
10 TRCN0000049412 GAGAAGATTGTGGCTGGCTAT pLKO.1 570 CDS 100% 4.050 2.835 N RPIA n/a
11 TRCN0000049409 GCTGATGAAGTAGATGCTGAT pLKO.1 510 CDS 100% 4.050 2.430 N RPIA n/a
12 TRCN0000327903 GCTGATGAAGTAGATGCTGAT pLKO_005 510 CDS 100% 4.050 2.430 N RPIA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11653 pDONR223 100% 76.2% 76.2% None 1_222del n/a
2 ccsbBroad304_11653 pLX_304 0% 76.2% 76.2% V5 1_222del n/a
3 TRCN0000465621 AACAAAACTCGTAACTTCCCCATC pLX_317 52.8% 76.2% 76.2% V5 1_222del n/a
Download CSV