Transcript: Human NM_144778.4

Homo sapiens muscleblind like splicing regulator 2 (MBNL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
MBNL2 (10150)
Length:
4691
CDS:
804..1907

Additional Resources:

NCBI RefSeq record:
NM_144778.4
NBCI Gene record:
MBNL2 (10150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_144778.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102457 CGTAACCGTTTGTATGGATTA pLKO.1 1445 CDS 100% 10.800 15.120 N Mbnl2 n/a
2 TRCN0000147101 CGTAACCGTTTGTATGGATTA pLKO.1 1445 CDS 100% 10.800 15.120 N MBNL2 n/a
3 TRCN0000102456 CCGTTTGTATGGATTACATAA pLKO.1 1450 CDS 100% 13.200 9.240 N Mbnl2 n/a
4 TRCN0000331017 GCTAGTGCTGCTATCTCATAT pLKO_005 2062 3UTR 100% 13.200 9.240 N MBNL2 n/a
5 TRCN0000147995 GCTCTGATGAAGAATGCAAAT pLKO.1 889 CDS 100% 10.800 7.560 N MBNL2 n/a
6 TRCN0000102459 CAAAGAGACAAGCACTTGAAA pLKO.1 1639 CDS 100% 5.625 3.938 N Mbnl2 n/a
7 TRCN0000178919 CAACACCGTAACCGTTTGTAT pLKO.1 1439 CDS 100% 5.625 3.938 N MBNL2 n/a
8 TRCN0000331082 CAACACCGTAACCGTTTGTAT pLKO_005 1439 CDS 100% 5.625 3.938 N MBNL2 n/a
9 TRCN0000149998 CCAGCAGATGCAATTTATGTT pLKO.1 1097 CDS 100% 5.625 3.938 N MBNL2 n/a
10 TRCN0000353711 CCAGCAGATGCAATTTATGTT pLKO_005 1097 CDS 100% 5.625 3.938 N MBNL2 n/a
11 TRCN0000102458 CGGCTATTAGCTTTGCTCCTT pLKO.1 1180 CDS 100% 2.640 1.848 N Mbnl2 n/a
12 TRCN0000180132 CGGCTATTAGCTTTGCTCCTT pLKO.1 1180 CDS 100% 2.640 1.848 N MBNL2 n/a
13 TRCN0000353712 CGGCTATTAGCTTTGCTCCTT pLKO_005 1180 CDS 100% 2.640 1.848 N MBNL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144778.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02332 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02332 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478908 AACCTATTACAGCCGGGGGGAGCC pLX_317 36% 100% 100% V5 n/a
Download CSV