Construct: ORF TRCN0000478908
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003954.2_s317c1
- Derived from:
- ccsbBroadEn_02332
- DNA Barcode:
- AACCTATTACAGCCGGGGGGAGCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MBNL2 (10150)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478908
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10150 | MBNL2 | muscleblind like splicing r... | NM_144778.4 | 100% | 100% | |
| 2 | human | 10150 | MBNL2 | muscleblind like splicing r... | XM_005254022.3 | 96.7% | 96.7% | 957_958ins36 |
| 3 | human | 10150 | MBNL2 | muscleblind like splicing r... | XM_005254018.3 | 95.3% | 95.3% | 803_856del |
| 4 | human | 10150 | MBNL2 | muscleblind like splicing r... | NM_001306070.1 | 92.4% | 88.9% | (many diffs) |
| 5 | human | 10150 | MBNL2 | muscleblind like splicing r... | XM_005254021.3 | 92.2% | 92.2% | 803_856del;1011_1012ins36 |
| 6 | human | 10150 | MBNL2 | muscleblind like splicing r... | NM_207304.2 | 91.9% | 86.6% | (many diffs) |
| 7 | human | 10150 | MBNL2 | muscleblind like splicing r... | XM_006719912.3 | 88.3% | 84.9% | (many diffs) |
| 8 | human | 10150 | MBNL2 | muscleblind like splicing r... | XM_005254019.3 | 87.7% | 82.6% | (many diffs) |
| 9 | human | 10150 | MBNL2 | muscleblind like splicing r... | XM_024449301.1 | 78.4% | 70.7% | (many diffs) |
| 10 | human | 10150 | MBNL2 | muscleblind like splicing r... | XM_024449300.1 | 75.7% | 69.9% | (many diffs) |
| 11 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XM_006518375.3 | 93.2% | 97.8% | (many diffs) |
| 12 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | NM_207515.2 | 90% | 94.5% | (many diffs) |
| 13 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XM_006518371.3 | 88.9% | 93.2% | (many diffs) |
| 14 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | NM_175341.4 | 85.8% | 90.1% | (many diffs) |
| 15 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XM_006518374.3 | 85.8% | 90.1% | (many diffs) |
| 16 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XM_006518376.3 | 84.3% | 84.5% | (many diffs) |
| 17 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XM_006518373.1 | 80.4% | 80.6% | (many diffs) |
| 18 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XR_001781083.1 | 16.8% | (many diffs) | |
| 19 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XR_001781084.1 | 16.5% | (many diffs) | |
| 20 | mouse | 105559 | Mbnl2 | muscleblind like splicing f... | XR_001781082.1 | 16.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1170
- ORF length:
- 1101
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctttgaac gttgccccag tcagagatac aaaatggctg acattagaag 121 tctgcagaca gtttcaaaga ggaacatgct cacgctctga tgaagaatgc aaatttgctc 181 atccccccaa aagttgtcag gttgaaaatg gaagagtaat tgcctgcttt gattccctaa 241 agggccgttg ttcgagagag aactgcaagt atcttcaccc tccgacacac ttaaaaactc 301 aactagaaat taatggaagg aacaatttga ttcagcaaaa aactgcagca gcaatgcttg 361 cccagcagat gcaatttatg tttccaggaa caccacttca tccagtgccc actttccctg 421 taggtcccgc gatagggaca aatacggcta ttagctttgc tccttaccta gcacctgtaa 481 cccctggagt tgggttggtc ccaacggaaa ttctgcccac cacgcctgtt attgttcccg 541 gaagtccacc ggtcactgtc ccgggctcaa ctgcaactca gaaacttctc aggactgaca 601 aactggaggt atgcagggag ttccagcgag gaaactgtgc ccggggagag accgactgcc 661 gctttgcaca ccccgcagac agcaccatga tcgacacaag tgacaacacc gtaaccgttt 721 gtatggatta cataaagggg cgttgcatga gggagaaatg caaatatttt cacccTCCTG 781 CACACTTGCA GGCCAAAATC AAAGCTGCGC AGCACCAAGC CAACCAAGCT GCGGTGGCCG 841 CCCAGGCAGC CGCGGCCGCG GCCACAGTCA TGGCCTTTCC CCCTGGTGCT CTTCATCCTT 901 TACCAAAGAG ACAAGCACTT GAAAAAAGCA ATGGTACCAG CGCGGTCTTT AACCCCAGCG 961 TCTTGCACTA CCAGCAGGCT CTCACCAGCG CACAGTTGCA GCAACACGCC GCGTTCATTC 1021 CAACAGGGTC AGTTTTGTGC ATGACACCCG CTACCAGTAT TGTACCCATG ATGCACAGCG 1081 CTACGTCCGC CACTGTCTCT GCAGCAACAA CTCCTGCAAC AAGTGTCCCC TTCGCAGCAA 1141 CAGCCACAGC CAATCAGATA ATTCTGAAAT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1201 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1261 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAACCT 1321 ATTACAGCCG GGGGGAGCCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1381 tgaaagatt