Transcript: Mouse NM_145076.4

Mus musculus tripartite motif-containing 24 (Trim24), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Trim24 (21848)
Length:
6191
CDS:
301..3456

Additional Resources:

NCBI RefSeq record:
NM_145076.4
NBCI Gene record:
Trim24 (21848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145076.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088519 CGGTGCAGTCACCAAATTCAT pLKO.1 2273 CDS 100% 5.625 7.875 N Trim24 n/a
2 TRCN0000288110 CGGTGCAGTCACCAAATTCAT pLKO_005 2273 CDS 100% 5.625 7.875 N Trim24 n/a
3 TRCN0000295441 AGTGATCATAGATACTCTAAT pLKO_005 1101 CDS 100% 13.200 9.240 N Trim24 n/a
4 TRCN0000088522 CCTCTAACTGTGCCTGATTAT pLKO.1 3088 CDS 100% 13.200 9.240 N Trim24 n/a
5 TRCN0000088521 CCACCACGCTTAATAAACTTT pLKO.1 1837 CDS 100% 5.625 3.938 N Trim24 n/a
6 TRCN0000288111 CCACCACGCTTAATAAACTTT pLKO_005 1837 CDS 100% 5.625 3.938 N Trim24 n/a
7 TRCN0000088518 GCTGTGCTAGAGATTTCTCAT pLKO.1 3476 3UTR 100% 4.950 3.465 N Trim24 n/a
8 TRCN0000288035 GCTGTGCTAGAGATTTCTCAT pLKO_005 3476 3UTR 100% 4.950 3.465 N Trim24 n/a
9 TRCN0000021260 CCATGAAATGAGCCTGGCTTT pLKO.1 3054 CDS 100% 4.050 2.835 N TRIM24 n/a
10 TRCN0000319203 CCATGAAATGAGCCTGGCTTT pLKO_005 3054 CDS 100% 4.050 2.835 N TRIM24 n/a
11 TRCN0000088520 CCCAAGTTGGAGTCATTCGAT pLKO.1 659 CDS 100% 3.000 2.100 N Trim24 n/a
12 TRCN0000288036 CCCAAGTTGGAGTCATTCGAT pLKO_005 659 CDS 100% 3.000 2.100 N Trim24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145076.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489756 ACGCGTAAGGTGTACTAGAAAATC pLX_317 11.5% 88.9% 93.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV