Transcript: Mouse NM_145125.3

Mus musculus bromodomain and WD repeat domain containing 1 (Brwd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Brwd1 (93871)
Length:
8547
CDS:
127..7041

Additional Resources:

NCBI RefSeq record:
NM_145125.3
NBCI Gene record:
Brwd1 (93871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304524 ACGGACGTGTAGGCGTAAATA pLKO_005 2514 CDS 100% 15.000 21.000 N Brwd1 n/a
2 TRCN0000304523 ACTCGGAAGAGAGTCTATTTA pLKO_005 4930 CDS 100% 15.000 21.000 N Brwd1 n/a
3 TRCN0000304522 CATAATGCAAGAACGTTTAAT pLKO_005 3829 CDS 100% 15.000 21.000 N Brwd1 n/a
4 TRCN0000084535 CGGATCTGTATCACTAGAGAA pLKO.1 5739 CDS 100% 4.950 6.930 N Brwd1 n/a
5 TRCN0000084534 GCAGCATATTTATATGGGATA pLKO.1 1598 CDS 100% 4.050 5.670 N Brwd1 n/a
6 TRCN0000301846 GCAGCATATTTATATGGGATA pLKO_005 1598 CDS 100% 4.050 5.670 N Brwd1 n/a
7 TRCN0000084537 GCAAAGACATTCGATTGATAT pLKO.1 4268 CDS 100% 13.200 10.560 N Brwd1 n/a
8 TRCN0000304521 AGACTGTCATTAATGTCTTAT pLKO_005 7514 3UTR 100% 13.200 9.240 N Brwd1 n/a
9 TRCN0000084536 CCTGTATGTAATAGGGAGAAA pLKO.1 2430 CDS 100% 4.950 3.465 N Brwd1 n/a
10 TRCN0000084533 GCCAGACTTGTGGTCAGAAAT pLKO.1 7665 3UTR 100% 13.200 7.920 N Brwd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145125.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08359 pDONR223 100% 4.5% 4.9% None (many diffs) n/a
2 ccsbBroad304_08359 pLX_304 0% 4.5% 4.9% V5 (many diffs) n/a
3 TRCN0000475291 CCAGAAATCCATACCTAACTATTT pLX_317 100% 4.5% 4.9% V5 (many diffs) n/a
Download CSV