Transcript: Mouse NM_145131.1

Mus musculus pitrilysin metallepetidase 1 (Pitrm1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-16
Taxon:
Mus musculus (mouse)
Gene:
Pitrm1 (69617)
Length:
3547
CDS:
18..3128

Additional Resources:

NCBI RefSeq record:
NM_145131.1
NBCI Gene record:
Pitrm1 (69617)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031651 GCCAGCGATTACACGATATAT pLKO.1 435 CDS 100% 15.000 21.000 N Pitrm1 n/a
2 TRCN0000324878 GCCAGCGATTACACGATATAT pLKO_005 435 CDS 100% 15.000 21.000 N Pitrm1 n/a
3 TRCN0000031652 CGGATCAAGAAGTATCTACTA pLKO.1 2316 CDS 100% 4.950 6.930 N Pitrm1 n/a
4 TRCN0000324790 CGGATCAAGAAGTATCTACTA pLKO_005 2316 CDS 100% 4.950 6.930 N Pitrm1 n/a
5 TRCN0000031653 CGTGTATTTGGATGCAACTTT pLKO.1 500 CDS 100% 5.625 4.500 N Pitrm1 n/a
6 TRCN0000031649 GCCCGTCTAATGACAGCTAAA pLKO.1 2673 CDS 100% 10.800 7.560 N Pitrm1 n/a
7 TRCN0000324874 GCCCGTCTAATGACAGCTAAA pLKO_005 2673 CDS 100% 10.800 7.560 N Pitrm1 n/a
8 TRCN0000031650 CCAGACGACAAGTATTATGAA pLKO.1 1533 CDS 100% 5.625 3.938 N Pitrm1 n/a
9 TRCN0000353949 CCAGACGACAAGTATTATGAA pLKO_005 1533 CDS 100% 5.625 3.938 N Pitrm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145131.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15717 pDONR223 0% 81.6% 86.5% None (many diffs) n/a
2 ccsbBroad304_15717 pLX_304 0% 81.6% 86.5% V5 (many diffs) n/a
3 TRCN0000471723 AACCCAGACTCCGGGTGATACACA pLX_317 11.7% 81.6% 86.5% V5 (many diffs) n/a
Download CSV