Transcript: Mouse NM_145218.3

Mus musculus Williams-Beuren syndrome chromosome region 17 homolog (human) (Wbscr17), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Wbscr17 (212996)
Length:
4196
CDS:
923..2719

Additional Resources:

NCBI RefSeq record:
NM_145218.3
NBCI Gene record:
Wbscr17 (212996)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145218.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093902 GCAGCTTAATGGCTTATCTAA pLKO.1 1150 CDS 100% 5.625 7.875 N Wbscr17 n/a
2 TRCN0000093903 GCTTCGTAATAATAAGGCCAA pLKO.1 2326 CDS 100% 2.160 3.024 N Wbscr17 n/a
3 TRCN0000093901 CGTTGGAACTTCATCCAGAAT pLKO.1 2573 CDS 100% 4.950 3.960 N Wbscr17 n/a
4 TRCN0000093899 CGCTTACTGCTCAGCTCATTT pLKO.1 3645 3UTR 100% 13.200 9.240 N Wbscr17 n/a
5 TRCN0000093900 GCGGAAGAAGAAACCGTATAA pLKO.1 2062 CDS 100% 13.200 9.240 N Wbscr17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145218.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08854 pDONR223 100% 89.4% 98.4% None (many diffs) n/a
2 ccsbBroad304_08854 pLX_304 0% 89.4% 98.4% V5 (many diffs) n/a
3 TRCN0000477589 TCGAAATTATAATTCTGGCCCTCA pLX_317 28.2% 89.4% 98.4% V5 (many diffs) n/a
Download CSV