Transcript: Human NM_145249.3

Homo sapiens interferon alpha inducible protein 27 like 1 (IFI27L1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IFI27L1 (122509)
Length:
693
CDS:
238..552

Additional Resources:

NCBI RefSeq record:
NM_145249.3
NBCI Gene record:
IFI27L1 (122509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435525 CAGTAGGAATCGCCGCATCCT pLKO_005 350 CDS 100% 0.880 1.232 N IFI27L1 n/a
2 TRCN0000183060 CTCTGTGACATCTAAAGTTAT pLKO.1 474 CDS 100% 13.200 9.240 N IFI27L1 n/a
3 TRCN0000415725 GGCTTCACCTCAGTAGGAATC pLKO_005 340 CDS 100% 6.000 4.200 N IFI27L1 n/a
4 TRCN0000180389 GCAGCCAAGATGATGTCTACA pLKO.1 376 CDS 100% 4.950 3.465 N IFI27L1 n/a
5 TRCN0000416307 GTGGCTATTCTGCAGTCAGTG pLKO_005 439 CDS 100% 4.050 2.835 N IFI27L1 n/a
6 TRCN0000180889 GATGATGTCTACAGCAGCCAT pLKO.1 384 CDS 100% 2.640 1.848 N IFI27L1 n/a
7 TRCN0000433325 GGCTTTGCTGGGACAGCTCTT pLKO_005 499 CDS 100% 1.350 0.945 N IFI27L1 n/a
8 TRCN0000181181 CCATAGCAGCCAAGATGATGT pLKO.1 371 CDS 100% 4.950 2.475 Y IFI27L1 n/a
9 TRCN0000244590 CTCCATAGCAGCCAAGATGAT pLKO_005 369 CDS 100% 4.950 2.475 Y IFI27L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145249.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04761 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04761 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474816 TACGTCAAACCCCTGGACCTTCGC pLX_317 100% 100% 100% V5 n/a
Download CSV