Transcript: Human NM_145294.5

Homo sapiens WD repeat domain 90 (WDR90), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
WDR90 (197335)
Length:
5540
CDS:
53..5299

Additional Resources:

NCBI RefSeq record:
NM_145294.5
NBCI Gene record:
WDR90 (197335)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145294.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418309 TGACGGGACGATACCTGTATG pLKO_005 252 CDS 100% 10.800 15.120 N WDR90 n/a
2 TRCN0000016679 CGCTACATCCACGTCCGGTTT pLKO.1 704 CDS 100% 1.350 1.890 N WDR90 n/a
3 TRCN0000427381 GACTCCTATGCCTCGGGAAAT pLKO_005 646 CDS 100% 10.800 8.640 N WDR90 n/a
4 TRCN0000433626 AGTGCACCTGTGCAGGTTTAC pLKO_005 5209 CDS 100% 10.800 7.560 N WDR90 n/a
5 TRCN0000430356 GATGGCAGCAGCTCACTATTG pLKO_005 1304 CDS 100% 10.800 7.560 N WDR90 n/a
6 TRCN0000016678 CCTCAACGTCTTCAGACACTT pLKO.1 79 CDS 100% 4.950 3.465 N WDR90 n/a
7 TRCN0000016680 CATCCGTGTGTCTTTCTCCAA pLKO.1 343 CDS 100% 2.640 1.848 N WDR90 n/a
8 TRCN0000016681 CCTGTGCTTTGAGCCTGCCAT pLKO.1 595 CDS 100% 0.880 0.616 N WDR90 n/a
9 TRCN0000016682 CCTGAGGCTCAAGGGCGTCAT pLKO.1 1126 CDS 100% 0.000 0.000 N WDR90 n/a
10 TRCN0000122726 CCAGGTTGTCAATGGCCTCAT pLKO.1 5375 3UTR 100% 4.050 2.430 N WDR90 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145294.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13376 pDONR223 100% 16.5% 15.3% None (many diffs) n/a
2 ccsbBroad304_13376 pLX_304 0% 16.5% 15.3% V5 (many diffs) n/a
3 TRCN0000469226 GATCTCTTAAACCATCCATGTATC pLX_317 47.3% 16.5% 15.3% V5 (many diffs) n/a
Download CSV