Transcript: Human NM_145313.4

Homo sapiens RasGEF domain family member 1A (RASGEF1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
RASGEF1A (221002)
Length:
3382
CDS:
228..1673

Additional Resources:

NCBI RefSeq record:
NM_145313.4
NBCI Gene record:
RASGEF1A (221002)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145313.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047368 CGGGCACATTAACTTTAAGAA pLKO.1 1433 CDS 100% 5.625 7.875 N RASGEF1A n/a
2 TRCN0000432885 CCCGATAGGACGTACATCTTC pLKO_005 420 CDS 100% 4.950 6.930 N RASGEF1A n/a
3 TRCN0000423209 ACGTGCACTAACTGGGTTTAA pLKO_005 1705 3UTR 100% 13.200 10.560 N RASGEF1A n/a
4 TRCN0000423626 GGACAGGGTCAGCAGCATTTA pLKO_005 908 CDS 100% 13.200 9.240 N RASGEF1A n/a
5 TRCN0000413646 GTATCCATGATAACATCTTAT pLKO_005 1920 3UTR 100% 13.200 9.240 N RASGEF1A n/a
6 TRCN0000047370 CGCATGTTGGAGTTCTTCATT pLKO.1 1101 CDS 100% 5.625 3.938 N RASGEF1A n/a
7 TRCN0000047372 CCTCTTCGTTAAGGACATCTA pLKO.1 1376 CDS 100% 4.950 3.465 N RASGEF1A n/a
8 TRCN0000047371 GCTGAAGTCTTTCTCAGCCAA pLKO.1 554 CDS 100% 0.264 0.185 N RASGEF1A n/a
9 TRCN0000047369 CCTGTGTTCAACCTCTTCGTT pLKO.1 1365 CDS 100% 3.000 1.800 N RASGEF1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145313.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13418 pDONR223 100% 88.8% 88.7% None 1_159del;741C>A;1393A>G n/a
2 ccsbBroad304_13418 pLX_304 0% 88.8% 88.7% V5 1_159del;741C>A;1393A>G n/a
3 TRCN0000466422 CACAAGGAGCGTGCCTGTATGTTT pLX_317 32.6% 88.8% 88.7% V5 1_159del;741C>A;1393A>G n/a
Download CSV