Transcript: Mouse NM_145360.2

Mus musculus isopentenyl-diphosphate delta isomerase (Idi1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Idi1 (319554)
Length:
2883
CDS:
255..1106

Additional Resources:

NCBI RefSeq record:
NM_145360.2
NBCI Gene record:
Idi1 (319554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099091 GCGGAGATGTGTATTCTTATT pLKO.1 474 CDS 100% 13.200 6.600 Y Idi1 n/a
2 TRCN0000099092 GTGGGATAACTTAAACCATTT pLKO.1 1046 CDS 100% 10.800 5.400 Y Idi1 n/a
3 TRCN0000099090 CCAGCGTAAATGCTCCTGTAA pLKO.1 1833 3UTR 100% 4.950 2.475 Y Idi1 n/a
4 TRCN0000099094 CCCTTGGAAGAGGTTGATCTA pLKO.1 777 CDS 100% 4.950 2.475 Y Idi1 n/a
5 TRCN0000099093 TGCAGATACTTTCCTCTTCAA pLKO.1 1022 CDS 100% 4.950 2.475 Y Idi1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10897 pDONR223 100% 68.3% 69.6% None (many diffs) n/a
2 TRCN0000473963 TCAAGCGGATCTCGCTTAGTCTGT pLX_317 74.7% 68.3% 69.6% V5 (many diffs) n/a
3 ccsbBroadEn_10898 pDONR223 100% 68.1% 69.2% None (many diffs) n/a
4 ccsbBroad304_10898 pLX_304 0% 68.1% 69.2% V5 (many diffs) n/a
5 TRCN0000471142 CTAAGACAGGCGATTACCCGGCTA pLX_317 61.9% 68.1% 69.2% V5 (many diffs) n/a
6 ccsbBroadEn_15460 pDONR223 0% 68.1% 69.2% None (many diffs) n/a
7 ccsbBroad304_15460 pLX_304 0% 68.1% 69.2% V5 (many diffs) n/a
8 TRCN0000479160 TTTGCTGATTAGCCTGACGATGTA pLX_317 59% 68.1% 69.2% V5 (many diffs) n/a
Download CSV