Transcript: Mouse NM_145392.2

Mus musculus BCL2-associated athanogene 2 (Bag2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Bag2 (213539)
Length:
1815
CDS:
60..692

Additional Resources:

NCBI RefSeq record:
NM_145392.2
NBCI Gene record:
Bag2 (213539)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115173 GAGCCACTTAATGTCACTTTA pLKO.1 455 CDS 100% 13.200 18.480 N Bag2 n/a
2 TRCN0000325258 GAGCCACTTAATGTCACTTTA pLKO_005 455 CDS 100% 13.200 18.480 N Bag2 n/a
3 TRCN0000115172 GCCATTAAACTCCTAGAGCAT pLKO.1 618 CDS 100% 2.640 3.696 N Bag2 n/a
4 TRCN0000325333 GCCATTAAACTCCTAGAGCAT pLKO_005 618 CDS 100% 2.640 3.696 N Bag2 n/a
5 TRCN0000115174 GCAGAACACTGACGGCAAATT pLKO.1 665 CDS 100% 13.200 9.240 N Bag2 n/a
6 TRCN0000325259 GCAGAACACTGACGGCAAATT pLKO_005 665 CDS 100% 13.200 9.240 N Bag2 n/a
7 TRCN0000115175 GCCAGGACATGAGGCAGATTA pLKO.1 256 CDS 100% 13.200 9.240 N Bag2 n/a
8 TRCN0000115171 CCCATCTTGAACTGGACTCTA pLKO.1 894 3UTR 100% 4.950 3.465 N Bag2 n/a
9 TRCN0000325332 CCCATCTTGAACTGGACTCTA pLKO_005 894 3UTR 100% 4.950 3.465 N Bag2 n/a
10 TRCN0000033592 GAGAAAGAAATCCTTCTGGAA pLKO.1 213 CDS 100% 2.640 1.584 N BAG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145392.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02186 pDONR223 100% 85% 93.3% None (many diffs) n/a
2 ccsbBroad304_02186 pLX_304 0% 85% 93.3% V5 (many diffs) n/a
3 TRCN0000474133 GTGCCCCCTTAACCACTTTGTTTT pLX_317 72.8% 85% 93.3% V5 (many diffs) n/a
Download CSV