Transcript: Mouse NM_145421.2

Mus musculus abhydrolase domain containing 17A (Abhd17a), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Abhd17a (216169)
Length:
1473
CDS:
352..1284

Additional Resources:

NCBI RefSeq record:
NM_145421.2
NBCI Gene record:
Abhd17a (216169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032199 CTTCGATGCTTTCCCTAACAT pLKO.1 1041 CDS 100% 5.625 7.875 N Abhd17a n/a
2 TRCN0000032201 GTTCTCTTCTCGCATGGCAAT pLKO.1 691 CDS 100% 4.050 5.670 N Abhd17a n/a
3 TRCN0000032203 CATTGAGCTGTACAGTCAATA pLKO.1 1209 CDS 100% 1.320 1.848 N Abhd17a n/a
4 TRCN0000032200 GCTGGATACCATCGAGGTCTT pLKO.1 597 CDS 100% 4.050 3.240 N Abhd17a n/a
5 TRCN0000243819 AGGACGAGGTGATCGACTTCT pLKO_005 1112 CDS 100% 4.950 3.465 N ABHD17AP1 n/a
6 TRCN0000312891 CATCGAGAAGGTGTCGAAGAT pLKO_005 1059 CDS 100% 4.950 3.465 N Abhd17a n/a
7 TRCN0000032202 GAAGAACCTCTATGCTGACAT pLKO.1 828 CDS 100% 4.950 3.465 N Abhd17a n/a
8 TRCN0000311984 GAAGAACCTCTATGCTGACAT pLKO_005 828 CDS 100% 4.950 3.465 N Abhd17a n/a
9 TRCN0000075286 CACCAAGAAGACCTACTGCTT pLKO.1 1023 CDS 100% 2.640 1.848 N ABHD17A n/a
10 TRCN0000312934 GCAGGGACCTCAGCAGTACAT pLKO_005 1292 3UTR 100% 1.650 1.155 N Abhd17a n/a
11 TRCN0000312935 GCCAGATGTGCAGCTTCTATG pLKO_005 725 CDS 100% 10.800 6.480 N Abhd17a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04263 pDONR223 100% 87.8% 92.9% None (many diffs) n/a
2 ccsbBroad304_04263 pLX_304 0% 87.8% 92.9% V5 (many diffs) n/a
3 TRCN0000478384 CTCTCTCTTGTATTCCTTTCAAGT pLX_317 29.2% 87.8% 92.9% V5 (many diffs) n/a
4 ccsbBroadEn_12734 pDONR223 100% 65.9% 68.3% None (many diffs) n/a
5 ccsbBroad304_12734 pLX_304 0% 65.9% 68.3% V5 (many diffs) n/a
6 TRCN0000465715 CAGCATGCTCTGCGTCTCATCCAG pLX_317 52% 65.9% 68.3% V5 (many diffs) n/a
Download CSV