Transcript: Mouse NM_145422.4

Mus musculus RNA 2',3'-cyclic phosphate and 5'-OH ligase (Rtcb), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rtcb (28088)
Length:
1979
CDS:
87..1604

Additional Resources:

NCBI RefSeq record:
NM_145422.4
NBCI Gene record:
Rtcb (28088)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075139 CCGCTTGCTAAGAACCAATTT pLKO.1 458 CDS 100% 13.200 18.480 N RTCB n/a
2 TRCN0000290259 CCGCTTGCTAAGAACCAATTT pLKO_005 458 CDS 100% 13.200 18.480 N RTCB n/a
3 TRCN0000119949 CCTGATGTCCATTCAGGCTAT pLKO.1 342 CDS 100% 0.405 0.567 N Rtcb n/a
4 TRCN0000314328 CCTGATGTCCATTCAGGCTAT pLKO_005 342 CDS 100% 0.405 0.567 N Rtcb n/a
5 TRCN0000119950 CTATGATGTGTCGCACAATAT pLKO.1 1130 CDS 100% 13.200 9.240 N Rtcb n/a
6 TRCN0000314330 CTATGATGTGTCGCACAATAT pLKO_005 1130 CDS 100% 13.200 9.240 N Rtcb n/a
7 TRCN0000119951 CCAAGCTATGTTTGACCACAT pLKO.1 518 CDS 100% 4.050 2.835 N Rtcb n/a
8 TRCN0000119947 GATCCGAATTGCAGAGCTGTT pLKO.1 1678 3UTR 100% 4.050 2.835 N Rtcb n/a
9 TRCN0000314331 GATCCGAATTGCAGAGCTGTT pLKO_005 1678 3UTR 100% 4.050 2.835 N Rtcb n/a
10 TRCN0000119948 CGTCGTAACTTAGATTTCCAA pLKO.1 1404 CDS 100% 3.000 2.100 N Rtcb n/a
11 TRCN0000314257 CGTCGTAACTTAGATTTCCAA pLKO_005 1404 CDS 100% 3.000 2.100 N Rtcb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145422.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15843 pDONR223 0% 91.8% 99.4% None (many diffs) n/a
2 ccsbBroad304_15843 pLX_304 0% 91.8% 99.4% V5 (many diffs) n/a
3 TRCN0000472919 GCCGAACCTCGGAGATTTTCGCGG pLX_317 34% 91.7% 99.4% V5 (many diffs) n/a
4 ccsbBroadEn_08298 pDONR223 100% 91.8% 99.2% None (many diffs) n/a
5 ccsbBroad304_08298 pLX_304 0% 91.8% 99.2% V5 (many diffs) n/a
6 TRCN0000478865 ACTGTGATCAAAACATTAACCTTA pLX_317 24.8% 91.8% 99.2% V5 (many diffs) n/a
7 ccsbBroadEn_15844 pDONR223 0% 91.7% 99.4% None (many diffs) n/a
8 ccsbBroad304_15844 pLX_304 0% 91.7% 99.4% V5 (many diffs) n/a
9 TRCN0000468343 GTTCTTAATCACTCCACCAAGGAC pLX_317 32.4% 91.7% 99.4% V5 (many diffs) n/a
Download CSV