Transcript: Mouse NM_145441.3

Mus musculus UBX domain protein 2A (Ubxn2a), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Ubxn2a (217379)
Length:
2511
CDS:
185..961

Additional Resources:

NCBI RefSeq record:
NM_145441.3
NBCI Gene record:
Ubxn2a (217379)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030100 GATGGTGCAAGTCAGCAGTTT pLKO.1 434 CDS 100% 4.950 6.930 N Ubxn2a n/a
2 TRCN0000314247 GATGGTGCAAGTCAGCAGTTT pLKO_005 434 CDS 100% 4.950 6.930 N Ubxn2a n/a
3 TRCN0000012053 CCCTCAATGATAATCAACAAA pLKO.1 258 CDS 100% 5.625 4.500 N Gm6245 n/a
4 TRCN0000030101 GCTCTTCCTTTCCTCAGGTTT pLKO.1 845 CDS 100% 4.950 3.465 N Ubxn2a n/a
5 TRCN0000314318 GCTCTTCCTTTCCTCAGGTTT pLKO_005 845 CDS 100% 4.950 3.465 N Ubxn2a n/a
6 TRCN0000030103 CTGAACAACTTGGAGCCCATT pLKO.1 686 CDS 100% 4.050 2.835 N Ubxn2a n/a
7 TRCN0000314248 CTGAACAACTTGGAGCCCATT pLKO_005 686 CDS 100% 4.050 2.835 N Ubxn2a n/a
8 TRCN0000030102 GCAGATTTGAAGAATGCTGTA pLKO.1 893 CDS 100% 4.050 2.835 N Ubxn2a n/a
9 TRCN0000314319 GCAGATTTGAAGAATGCTGTA pLKO_005 893 CDS 100% 4.050 2.835 N Ubxn2a n/a
10 TRCN0000030099 GAAGAAGCAGATTTGAAGAAT pLKO.1 887 CDS 100% 5.625 3.375 N Ubxn2a n/a
11 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2083 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145441.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05134 pDONR223 100% 86.3% 83.9% None (many diffs) n/a
2 ccsbBroad304_05134 pLX_304 0% 86.3% 83.9% V5 (many diffs) n/a
3 TRCN0000477066 CCCCCTGAGCGTAGACCATACTCA pLX_317 51.7% 86.3% 83.9% V5 (many diffs) n/a
Download CSV