Transcript: Mouse NM_145488.1

Mus musculus peroxisomal biogenesis factor 6 (Pex6), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pex6 (224824)
Length:
3214
CDS:
38..2983

Additional Resources:

NCBI RefSeq record:
NM_145488.1
NBCI Gene record:
Pex6 (224824)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193213 CTACAGTGCTAATGGAAATTA pLKO.1 1030 CDS 100% 15.000 21.000 N Pex6 n/a
2 TRCN0000279181 CTACAGTGCTAATGGAAATTA pLKO_005 1030 CDS 100% 15.000 21.000 N Pex6 n/a
3 TRCN0000279183 ACCGATGTGCAGACGGCATTT pLKO_005 1781 CDS 100% 10.800 15.120 N Pex6 n/a
4 TRCN0000279184 AGCGCATCCAACGCAAGTTTG pLKO_005 2952 CDS 100% 10.800 15.120 N Pex6 n/a
5 TRCN0000175273 CGAGAGTTACACATTGAGATT pLKO.1 995 CDS 100% 4.950 6.930 N Pex6 n/a
6 TRCN0000279115 CGAGAGTTACACATTGAGATT pLKO_005 995 CDS 100% 4.950 6.930 N Pex6 n/a
7 TRCN0000193567 GCTAATGGAAATTATGACCAT pLKO.1 1037 CDS 100% 2.640 3.696 N Pex6 n/a
8 TRCN0000173421 GTGAAGAAGGAGATCCTAGAA pLKO.1 2177 CDS 100% 4.950 3.465 N Pex6 n/a
9 TRCN0000279114 GTGAAGAAGGAGATCCTAGAA pLKO_005 2177 CDS 100% 4.950 3.465 N Pex6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145488.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491750 CTCTCCTCCCGGCACGGAATACTC pLX_317 10.6% 84.6% 87.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489298 CTACCGAAGACGTCTAGATGGGGC pLX_317 12.4% 84.5% 87.8% V5 (many diffs) n/a
Download CSV