Transcript: Mouse NM_145537.2

Mus musculus ER degradation enhancer, mannosidase alpha-like 2 (Edem2), mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Edem2 (108687)
Length:
2294
CDS:
139..1872

Additional Resources:

NCBI RefSeq record:
NM_145537.2
NBCI Gene record:
Edem2 (108687)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431816 GCTCATCGAGAGCGCAATGTA pLKO_005 1254 CDS 100% 5.625 7.875 N Edem2 n/a
2 TRCN0000126352 GTTCCACCCAAACAACTTCAT pLKO.1 1458 CDS 100% 4.950 6.930 N Edem2 n/a
3 TRCN0000126351 CGGAATTACACGCACTTCGAT pLKO.1 1000 CDS 100% 3.000 4.200 N Edem2 n/a
4 TRCN0000126349 CCTGGCTGAAACTGTGAAATA pLKO.1 1425 CDS 100% 13.200 10.560 N Edem2 n/a
5 TRCN0000426363 CCTCATAGCCACTGGATAATT pLKO_005 1865 CDS 100% 15.000 10.500 N Edem2 n/a
6 TRCN0000430934 GAGATGTCACCACCGTTTATT pLKO_005 2074 3UTR 100% 15.000 10.500 N Edem2 n/a
7 TRCN0000413963 GGGACCTTCATTGTGGAATTT pLKO_005 724 CDS 100% 13.200 9.240 N Edem2 n/a
8 TRCN0000423603 GAACGCCTCTGTGTTCGAAAC pLKO_005 471 CDS 100% 6.000 4.200 N Edem2 n/a
9 TRCN0000126353 GCTGCCAGAATTCTACAACAT pLKO.1 1182 CDS 100% 0.000 0.000 N Edem2 n/a
10 TRCN0000126350 CCCAAACAACTTCATCCACAA pLKO.1 1464 CDS 100% 4.050 2.430 N Edem2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08575 pDONR223 100% 88.5% 93.6% None (many diffs) n/a
2 ccsbBroad304_08575 pLX_304 0% 88.5% 93.6% V5 (many diffs) n/a
3 TRCN0000467820 CCCCACCAGAACCCCCGATCTGTC pLX_317 17.2% 88.5% 93.6% V5 (many diffs) n/a
Download CSV