Transcript: Mouse NM_145538.2

Mus musculus transmembrane protein 189 (Tmem189), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem189 (407243)
Length:
1700
CDS:
49..864

Additional Resources:

NCBI RefSeq record:
NM_145538.2
NBCI Gene record:
Tmem189 (407243)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039460 CCACGAAACATACTTCTGTAT pLKO.1 714 CDS 100% 4.950 2.970 N Tmem189 n/a
2 TRCN0000323961 CCACGAAACATACTTCTGTAT pLKO_005 714 CDS 100% 4.950 2.970 N Tmem189 n/a
3 TRCN0000039461 CGACATGAAATGGGCACAGAA pLKO.1 834 CDS 100% 4.950 2.970 N Tmem189 n/a
4 TRCN0000323960 CGACATGAAATGGGCACAGAA pLKO_005 834 CDS 100% 4.950 2.970 N Tmem189 n/a
5 TRCN0000039459 CCAAACCTGAACTGAAGCCAT pLKO.1 894 3UTR 100% 2.640 1.584 N Tmem189 n/a
6 TRCN0000324023 CCAAACCTGAACTGAAGCCAT pLKO_005 894 3UTR 100% 2.640 1.584 N Tmem189 n/a
7 TRCN0000039463 GCATGACTTCATCGAGACCAA pLKO.1 438 CDS 100% 2.640 1.584 N Tmem189 n/a
8 TRCN0000324027 GCATGACTTCATCGAGACCAA pLKO_005 438 CDS 100% 2.640 1.584 N Tmem189 n/a
9 TRCN0000039462 CCACAAGTGGTCACACACATA pLKO.1 606 CDS 100% 4.950 2.475 Y Tmem189 n/a
10 TRCN0000324026 CCACAAGTGGTCACACACATA pLKO_005 606 CDS 100% 4.950 2.475 Y Tmem189 n/a
11 TRCN0000087484 CGTCTTCTGTCTGACCATCTT pLKO.1 564 CDS 100% 4.950 2.475 Y Gm6194 n/a
12 TRCN0000087485 GCTAAACATGGCCTACAAGTT pLKO.1 492 CDS 100% 4.950 2.475 Y Gm6194 n/a
13 TRCN0000087487 CCCTTGGGAATGCTTCGTCTT pLKO.1 549 CDS 100% 4.050 2.025 Y Gm6194 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10085 pDONR223 100% 86.9% 91.8% None (many diffs) n/a
2 ccsbBroad304_10085 pLX_304 0% 86.9% 91.8% V5 (many diffs) n/a
3 TRCN0000476515 CCCCGTCATCGCAAGACTCACATA pLX_317 40.3% 86.9% 91.8% V5 (many diffs) n/a
Download CSV