Transcript: Mouse NM_145550.3

Mus musculus Yip1 domain family, member 1 (Yipf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Yipf1 (230584)
Length:
1333
CDS:
150..1070

Additional Resources:

NCBI RefSeq record:
NM_145550.3
NBCI Gene record:
Yipf1 (230584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126347 CCAGGTCTTTGACAGAATAAA pLKO.1 422 CDS 100% 15.000 21.000 N Yipf1 n/a
2 TRCN0000126346 GCTCTGTGTTGGTAATGACAT pLKO.1 865 CDS 100% 4.950 3.960 N Yipf1 n/a
3 TRCN0000126348 CTCTGTGTTGGTAATGACATT pLKO.1 866 CDS 100% 4.950 3.465 N Yipf1 n/a
4 TRCN0000126344 CACAGCATCCACTACTGGAAT pLKO.1 1141 3UTR 100% 4.950 2.970 N Yipf1 n/a
5 TRCN0000143501 GCCATAGCAATTAGTGGGAAT pLKO.1 546 CDS 100% 4.050 2.835 N YIPF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145550.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03414 pDONR223 100% 83.3% 87.5% None (many diffs) n/a
2 ccsbBroad304_03414 pLX_304 0% 83.3% 87.5% V5 (many diffs) n/a
3 TRCN0000467922 CTCCGACATGTTCATGGGGTGAAG pLX_317 45.8% 83.3% 87.5% V5 (many diffs) n/a
4 ccsbBroadEn_12037 pDONR223 100% 34.3% 34.9% None (many diffs) n/a
5 ccsbBroad304_12037 pLX_304 0% 34.3% 34.9% V5 (many diffs) n/a
6 TRCN0000465733 GTCATCTTCTTCCTGACTGTTAAT pLX_317 41.3% 34.3% 34.9% V5 (many diffs) n/a
Download CSV