Transcript: Mouse NM_145625.3

Mus musculus eukaryotic translation initiation factor 4B (Eif4b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Eif4b (75705)
Length:
3871
CDS:
179..2014

Additional Resources:

NCBI RefSeq record:
NM_145625.3
NBCI Gene record:
Eif4b (75705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426799 ACTACTCTCGGGATGATTATA pLKO_005 1122 CDS 100% 15.000 21.000 N Eif4b n/a
2 TRCN0000427090 ACCGGTATCGGGATGGGTATA pLKO_005 870 CDS 100% 10.800 15.120 N Eif4b n/a
3 TRCN0000416638 GACAAGTATCGAGATCGTTAC pLKO_005 842 CDS 100% 6.000 8.400 N Eif4b n/a
4 TRCN0000062601 CGGGATGATTATAGGCGTGAT pLKO.1 1130 CDS 100% 4.050 5.670 N EIF4B n/a
5 TRCN0000096832 GACCGCTATGAAGACCGCTAT pLKO.1 1064 CDS 100% 4.050 5.670 N Eif4b n/a
6 TRCN0000413875 CCATCTCCCTAACGGACTTTC pLKO_005 219 CDS 100% 10.800 8.640 N Eif4b n/a
7 TRCN0000429743 GTGAGATTTCTACTTTCTAAT pLKO_005 2369 3UTR 100% 13.200 9.240 N Eif4b n/a
8 TRCN0000096831 CCAACCTCTAAGCCTCCTAAA pLKO.1 1556 CDS 100% 10.800 7.560 N Eif4b n/a
9 TRCN0000437897 GCCCTATGATGTGACAGAAGA pLKO_005 487 CDS 100% 4.950 3.465 N Eif4b n/a
10 TRCN0000439178 GTTCAGCTCTGCAAGCAAGTA pLKO_005 1936 CDS 100% 4.950 3.465 N Eif4b n/a
11 TRCN0000096830 GCCAAAGAAACCTGAGGAGAA pLKO.1 1903 CDS 100% 4.050 2.835 N Eif4b n/a
12 TRCN0000436784 TTACCACGGGAACCCAGCAAT pLKO_005 554 CDS 100% 4.950 2.970 N Eif4b n/a
13 TRCN0000236426 GACAAGTATCGAGATCGTTAT pLKO_005 842 CDS 100% 10.800 15.120 N EIF4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145625.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06149 pDONR223 100% 90% 94.2% None (many diffs) n/a
2 ccsbBroad304_06149 pLX_304 0% 90% 94.2% V5 (many diffs) n/a
3 TRCN0000465580 TAACTTGACGAAAGGACCCTGTGC pLX_317 15.7% 90% 94.2% V5 (many diffs) n/a
Download CSV