Transcript: Human NM_145733.3

Homo sapiens septin 3 (SEPTIN3), transcript variant A, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SEPTIN3 (55964)
Length:
2618
CDS:
288..1364

Additional Resources:

NCBI RefSeq record:
NM_145733.3
NBCI Gene record:
SEPTIN3 (55964)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062032 CGGTTTCGACTTCAACATCAT pLKO.1 461 CDS 100% 4.950 6.930 N SEPTIN3 n/a
2 TRCN0000428632 TGGAGGATAAGACGGAGAATG pLKO_005 1021 CDS 100% 10.800 7.560 N SEPTIN3 n/a
3 TRCN0000062029 CCCAAGACAGTGGAGATCAAA pLKO.1 585 CDS 100% 5.625 3.938 N SEPTIN3 n/a
4 TRCN0000062031 CCTCAGCAAGGTTGTGAACAT pLKO.1 872 CDS 100% 4.950 3.465 N SEPTIN3 n/a
5 TRCN0000062030 GTGACACACAACATCCACTAT pLKO.1 1230 CDS 100% 4.950 3.465 N SEPTIN3 n/a
6 TRCN0000062028 CCCATTGAGAAGTACATCAAT pLKO.1 708 CDS 100% 0.563 0.394 N SEPTIN3 n/a
7 TRCN0000413833 TGGATCTTGAGTTCATGAAAC pLKO_005 850 CDS 100% 10.800 6.480 N SEPTIN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145733.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12293 pDONR223 100% 96.3% 96.3% None 1_39del n/a
2 ccsbBroad304_12293 pLX_304 0% 96.3% 96.3% V5 1_39del n/a
3 TRCN0000474640 CCTACGAATGCTAGCCAAAACCCC pLX_317 41.9% 96.3% 96.3% V5 1_39del n/a
Download CSV