Transcript: Human NM_145796.4

Homo sapiens pogo transposable element derived with ZNF domain (POGZ), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
POGZ (23126)
Length:
6370
CDS:
345..4292

Additional Resources:

NCBI RefSeq record:
NM_145796.4
NBCI Gene record:
POGZ (23126)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_145796.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005709 CCACGATGTAATGCTCAATTT pLKO.1 1191 CDS 100% 13.200 18.480 N POGZ n/a
2 TRCN0000005707 CACGTCTATCTACAACCTAAT pLKO.1 6101 3UTR 100% 10.800 15.120 N POGZ n/a
3 TRCN0000218065 AGACTCTTGTCACACTAATTG pLKO_005 595 CDS 100% 13.200 10.560 N POGZ n/a
4 TRCN0000005711 GCCACTATTTCTCCAGCATAT pLKO.1 1775 CDS 100% 10.800 7.560 N POGZ n/a
5 TRCN0000421458 GCTATTGATGAGATCTCTTTG pLKO_005 3429 CDS 100% 10.800 7.560 N Pogz n/a
6 TRCN0000005708 CCCAAGTATTTGGCTTTGTTT pLKO.1 2457 CDS 100% 5.625 3.938 N POGZ n/a
7 TRCN0000005710 CCCTAATCATTTCCCTACTTA pLKO.1 2348 CDS 100% 5.625 3.938 N POGZ n/a
8 TRCN0000098928 CGCACTCACTTGTCAGAAGAA pLKO.1 3753 CDS 100% 4.950 3.465 N Pogz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145796.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491523 TCCATTTGCTCACTTCTCCAGGCC pLX_317 7.7% 95.4% 93.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11681 pDONR223 100% 18.8% 18.7% None (many diffs) n/a
3 ccsbBroad304_11681 pLX_304 0% 18.8% 18.7% V5 (many diffs) n/a
4 TRCN0000467762 TAGATAGTTCGACTCTATTATGTG pLX_317 41.5% 18.8% 18.7% V5 (many diffs) n/a
Download CSV