Construct: ORF TRCN0000467762
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001699.1_s317c1
- Derived from:
- ccsbBroadEn_11681
- DNA Barcode:
- TAGATAGTTCGACTCTATTATGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- POGZ (23126)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467762
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23126 | POGZ | pogo transposable element d... | XM_024454305.1 | 26.3% | 26.3% | (many diffs) |
| 2 | human | 23126 | POGZ | pogo transposable element d... | NM_015100.4 | 25.5% | 25.5% | 1078_1079insGTACAA;1080G>A;1084_4230del |
| 3 | human | 23126 | POGZ | pogo transposable element d... | XM_005244999.3 | 25.5% | 25.5% | 1078_1079insGTACAA;1080G>A;1084_4230del |
| 4 | human | 23126 | POGZ | pogo transposable element d... | XM_005245000.4 | 25.5% | 25.5% | 1078_1079insGTACAA;1080G>A;1084_4230del |
| 5 | human | 23126 | POGZ | pogo transposable element d... | XM_005245001.2 | 25.5% | 25.5% | 1078_1079insGTACAA;1080G>A;1084_4230del |
| 6 | human | 23126 | POGZ | pogo transposable element d... | XM_017000744.1 | 25.4% | 25.4% | (many diffs) |
| 7 | human | 23126 | POGZ | pogo transposable element d... | NM_001194937.2 | 24.9% | 24.8% | (many diffs) |
| 8 | human | 23126 | POGZ | pogo transposable element d... | XM_017000745.2 | 24.9% | 24.8% | (many diffs) |
| 9 | human | 23126 | POGZ | pogo transposable element d... | XM_017000746.1 | 24.9% | 24.8% | (many diffs) |
| 10 | human | 23126 | POGZ | pogo transposable element d... | NM_207171.2 | 21.7% | 21.7% | (many diffs) |
| 11 | human | 23126 | POGZ | pogo transposable element d... | XM_005245005.2 | 21.7% | 21.7% | (many diffs) |
| 12 | human | 23126 | POGZ | pogo transposable element d... | XM_005245006.5 | 21.7% | 21.7% | (many diffs) |
| 13 | human | 23126 | POGZ | pogo transposable element d... | XM_017000748.1 | 21.7% | 21.7% | (many diffs) |
| 14 | human | 23126 | POGZ | pogo transposable element d... | XM_017000749.1 | 21.7% | 21.7% | (many diffs) |
| 15 | human | 23126 | POGZ | pogo transposable element d... | NM_001194938.2 | 21.1% | 21.1% | (many diffs) |
| 16 | human | 23126 | POGZ | pogo transposable element d... | NM_145796.4 | 18.8% | 18.7% | (many diffs) |
| 17 | human | 23126 | POGZ | pogo transposable element d... | XR_002959801.1 | 17.5% | (many diffs) | |
| 18 | mouse | 229584 | Pogz | pogo transposable element w... | NM_172683.3 | 23.6% | 24.7% | (many diffs) |
| 19 | mouse | 229584 | Pogz | pogo transposable element w... | XM_011240090.2 | 23.6% | 24.7% | (many diffs) |
| 20 | mouse | 229584 | Pogz | pogo transposable element w... | NM_001165948.1 | 23% | 24% | (many diffs) |
| 21 | mouse | 229584 | Pogz | pogo transposable element w... | XM_006501362.1 | 20.1% | 21% | (many diffs) |
| 22 | mouse | 229584 | Pogz | pogo transposable element w... | XM_006501363.1 | 19.4% | 20.3% | (many diffs) |
| 23 | mouse | 229584 | Pogz | pogo transposable element w... | XM_006501364.1 | 16.7% | 17.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1155
- ORF length:
- 1089
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggacaccgac ctgttcatgg aatgtgagga ggaggagttg gagccatggc 121 agaaaatcag tgatgtcatt gaggactctg tagttgaaga ttataattca gtggataaaa 181 ctaccacagt ttctgtgagc cagcagccag tctcggctcc agtgcccatc gctgcccatg 241 cttctgttgc tgggcacctc tctacatcca ccaccgttag tagcagcggg gcacagaaca 301 gcgacagtac aaagaagact cttgtcacac taattgccaa caacaatgct ggcaatcctt 361 tggtccagca aggtggacag ccactcatcc tgacccagaa tccagcccca ggtctgggca 421 caatggttac tcaaccagta ttgaggcctg ttcaggtcat gcagaatgcc aatcatgtga 481 ctagttcccc tgtggcctca caaccaatat ttatcactac gcagggattt cctgtaagga 541 atgtccggcc tgtacaaaat gcaatgaatc aggttgggat tgtgctgaac gtacagcaag 601 gccaaacggt tagaccaatt acactagttc cagccccagg tacccagttt gttaagccga 661 cagttggagt tccacaagtg ttctcccaga tgacccctgt gaggCCAGGC TCCACAATGC 721 CTGTGAGGCC CACCACCAAC ACCTTCACCA CCGTCATCCC GGCCACTCTT ACCATTCGAA 781 GCACCGTCCC ACAGTCCCAG TCCCAGCAGA CCAAGTCCAC TCCCAGCACT TCTACCACTC 841 CCACTGCCAC ACAGCCAACC TCACTGGGGC AACTAGCTGT TCAGTCTCCA GGCCAGTCAA 901 ACCAGACCAC GAATCCCAAG CTAGCTCCCT CCTTCCCCTC TCCACCTGCA GTGAGCATTG 961 CCAGCTTTGT CACTGTGAAG CGACCTGGTG TTACAGGCGA AAATAGCAAT GAAGTGGCCA 1021 AATTGGTGAA TACCCTTAAC ACCATCCCTT CCCTGGGCCA GAGTCCTGGG CCAGTGGTGG 1081 TGTCCAACAA CAGCTCTGCT CATGGCTCTC AAAGAACCAG CGGACCTGAG TCTTCAATGA 1141 AAGGTACAAT AACCTGCCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1201 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1261 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA TAGATAGTTC GACTCTATTA 1321 TGTGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt