Transcript: Mouse NM_145824.4

Mus musculus RAN binding protein 10 (Ranbp10), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ranbp10 (74334)
Length:
5308
CDS:
83..2029

Additional Resources:

NCBI RefSeq record:
NM_145824.4
NBCI Gene record:
Ranbp10 (74334)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145824.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379093 ACTCTCAGCGCAAGGCGTTAA pLKO_005 529 CDS 100% 10.800 15.120 N Ranbp10 n/a
2 TRCN0000102098 CCAGTAGGTCATCAGCTTGAT pLKO.1 1829 CDS 100% 4.950 6.930 N Ranbp10 n/a
3 TRCN0000331903 CCAGTAGGTCATCAGCTTGAT pLKO_005 1829 CDS 100% 4.950 6.930 N Ranbp10 n/a
4 TRCN0000102096 CGTGTCCATTACAAAGGTCAT pLKO.1 386 CDS 100% 4.050 5.670 N Ranbp10 n/a
5 TRCN0000102097 CGTCAATTACTCCGAGTCCAA pLKO.1 1441 CDS 100% 2.640 3.696 N Ranbp10 n/a
6 TRCN0000305169 CAGGTTGATGATAGCTTATTA pLKO_005 2439 3UTR 100% 15.000 10.500 N Ranbp10 n/a
7 TRCN0000430746 CGCTTGTACCCTGCGGTTAAT pLKO_005 287 CDS 100% 13.200 9.240 N Ranbp10 n/a
8 TRCN0000374569 GGAAGAGCAGGCATCCATAAA pLKO_005 1024 CDS 100% 13.200 9.240 N Ranbp10 n/a
9 TRCN0000305171 GTTCGACATTGAGGACTATAT pLKO_005 835 CDS 100% 13.200 9.240 N Ranbp10 n/a
10 TRCN0000305170 CCTGGTGCATCATGGGTATTG pLKO_005 958 CDS 100% 10.800 7.560 N Ranbp10 n/a
11 TRCN0000102095 CCCATTTAATTCTGTGCCTTA pLKO.1 4359 3UTR 100% 4.050 2.835 N Ranbp10 n/a
12 TRCN0000102099 GCAAAGGAAGAGATGGGTACA pLKO.1 498 CDS 100% 4.050 2.835 N Ranbp10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145824.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15950 pDONR223 0% 87.7% 93.5% None (many diffs) n/a
2 ccsbBroad304_15950 pLX_304 0% 87.7% 93.5% V5 (many diffs) n/a
3 TRCN0000471832 AGCAGACGTTGCATGCGCAATTCA pLX_317 24.5% 85% 72.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV