Transcript: Mouse NM_145939.2

Mus musculus asparagine-linked glycosylation 3 (alpha-1,3-mannosyltransferase) (Alg3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Alg3 (208624)
Length:
1425
CDS:
12..1328

Additional Resources:

NCBI RefSeq record:
NM_145939.2
NBCI Gene record:
Alg3 (208624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249394 TTGACCTTGGTCGTCAGTTTC pLKO_005 796 CDS 100% 10.800 8.640 N Alg3 n/a
2 TRCN0000249395 GGTTTCATCAATGGCACATAT pLKO_005 249 CDS 100% 13.200 9.240 N Alg3 n/a
3 TRCN0000249392 ACCGTGTCCATTCCATCTTTG pLKO_005 496 CDS 100% 10.800 7.560 N Alg3 n/a
4 TRCN0000257867 CACACCTAACCAGATTGTTTC pLKO_005 1010 CDS 100% 10.800 7.560 N Alg3 n/a
5 TRCN0000249393 TCTTCACCTCCAACTTCATTG pLKO_005 1036 CDS 100% 10.800 7.560 N Alg3 n/a
6 TRCN0000217251 CTTCAATGACCCAGTAGCTAT pLKO.1 527 CDS 100% 4.950 3.465 N Alg3 n/a
7 TRCN0000176104 GAACATCTTTGCTGTACTCTA pLKO.1 386 CDS 100% 4.950 2.970 N Alg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02347 pDONR223 100% 86.8% 88.8% None (many diffs) n/a
2 ccsbBroad304_02347 pLX_304 0% 86.8% 88.8% V5 (many diffs) n/a
3 TRCN0000480323 GCCTTACGCATACAACGGAACCCG pLX_317 29% 86.8% 88.8% V5 (many diffs) n/a
Download CSV