Transcript: Mouse NM_145963.2

Mus musculus potassium inwardly-rectifying channel, subfamily J, member 14 (Kcnj14), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Kcnj14 (211480)
Length:
2639
CDS:
186..1490

Additional Resources:

NCBI RefSeq record:
NM_145963.2
NBCI Gene record:
Kcnj14 (211480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069279 CGCCACTTCCATCGAACATAT pLKO.1 1218 CDS 100% 13.200 10.560 N Kcnj14 n/a
2 TRCN0000427941 GGTTGAACATCAGTGAGATAC pLKO_005 1769 3UTR 100% 10.800 7.560 N Kcnj14 n/a
3 TRCN0000069282 CCACAGCCCTAAGTCAAGTTT pLKO.1 1301 CDS 100% 5.625 3.938 N Kcnj14 n/a
4 TRCN0000069278 CCACAGATAGACCACACCTTT pLKO.1 1628 3UTR 100% 4.950 3.465 N Kcnj14 n/a
5 TRCN0000069808 CCTTTATTTCTCTGCTCCATT pLKO.1 1644 3UTR 100% 4.950 3.465 N Gm5522 n/a
6 TRCN0000069280 GAGCCAGGAAACAGTCGAGCT pLKO.1 228 CDS 100% 0.720 0.504 N Kcnj14 n/a
7 TRCN0000044577 GCGCTGGATGTGCCTGCTCTT pLKO.1 437 CDS 100% 0.000 0.000 N KCNJ14 n/a
8 TRCN0000069281 CCAGGATGTAGATGTTGGTTT pLKO.1 935 CDS 100% 4.950 2.970 N Kcnj14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145963.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00897 pDONR223 100% 88.1% 94.2% None (many diffs) n/a
2 ccsbBroad304_00897 pLX_304 0% 88.1% 94.2% V5 (many diffs) n/a
3 TRCN0000478066 TTGCCTTCCAGAGATTTTCTGTTT pLX_317 10% 88.1% 94.2% V5 (many diffs) n/a
Download CSV