Transcript: Mouse NM_145967.2

Mus musculus V-set and transmembrane domain containing 2A (Vstm2a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Vstm2a (211739)
Length:
3629
CDS:
285..995

Additional Resources:

NCBI RefSeq record:
NM_145967.2
NBCI Gene record:
Vstm2a (211739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201415 CCACAAGCTTCAGATATCCAA pLKO.1 611 CDS 100% 3.000 4.200 N Vstm2a n/a
2 TRCN0000425494 GACACTGTCACACGCTTTATT pLKO_005 1171 3UTR 100% 15.000 10.500 N Vstm2a n/a
3 TRCN0000373941 GGTGCTTTGCTTTAATCTAAA pLKO_005 981 CDS 100% 13.200 9.240 N VSTM2A n/a
4 TRCN0000412679 GGTGCTTTGCTTTAATCTAAA pLKO_005 981 CDS 100% 13.200 9.240 N Vstm2a n/a
5 TRCN0000373858 AGCTACAAGCCATGGACTTTC pLKO_005 929 CDS 100% 10.800 7.560 N VSTM2A n/a
6 TRCN0000373860 AGGCCTATCTGAAAGTCAATG pLKO_005 712 CDS 100% 10.800 7.560 N VSTM2A n/a
7 TRCN0000435368 AGGCCTATCTGAAAGTCAATG pLKO_005 712 CDS 100% 10.800 7.560 N Vstm2a n/a
8 TRCN0000191801 GCTTTAAGAATCCCATACATT pLKO.1 3014 3UTR 100% 5.625 3.938 N Vstm2a n/a
9 TRCN0000201191 GACCAAGATTAGTACAGTGAA pLKO.1 569 CDS 100% 4.950 3.465 N Vstm2a n/a
10 TRCN0000190530 GTACAACAAGGGCTTTCTTCT pLKO.1 339 CDS 100% 4.950 3.465 N Vstm2a n/a
11 TRCN0000202259 GATAGCTACAAGCCATGGACT pLKO.1 926 CDS 100% 2.640 1.848 N Vstm2a n/a
12 TRCN0000420826 CCGTGTTATATGTACAACAAG pLKO_005 328 CDS 100% 4.950 2.970 N Vstm2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13431 pDONR223 100% 80.5% 79.6% None (many diffs) n/a
2 ccsbBroad304_13431 pLX_304 0% 80.5% 79.6% V5 (many diffs) n/a
3 TRCN0000473383 AAGTCGTGTGCAGTGTTGCCGGTC pLX_317 64.3% 80.5% 79.6% V5 (many diffs) n/a
Download CSV