Transcript: Mouse NM_146015.2

Mus musculus epidermal growth factor-containing fibulin-like extracellular matrix protein 1 (Efemp1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Efemp1 (216616)
Length:
2036
CDS:
130..1611

Additional Resources:

NCBI RefSeq record:
NM_146015.2
NBCI Gene record:
Efemp1 (216616)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109682 CGGACCAAGTATGCATCAATT pLKO.1 686 CDS 100% 13.200 18.480 N Efemp1 n/a
2 TRCN0000348675 CTACACTTGTGTGGATATAAA pLKO_005 876 CDS 100% 15.000 10.500 N Efemp1 n/a
3 TRCN0000109683 GCAGAACCTGTCAGGATATAA pLKO.1 1115 CDS 100% 15.000 10.500 N Efemp1 n/a
4 TRCN0000351708 GCAGAACCTGTCAGGATATAA pLKO_005 1115 CDS 100% 15.000 10.500 N Efemp1 n/a
5 TRCN0000109680 GCAAGGATACTGTTCTGTGTT pLKO.1 1873 3UTR 100% 4.950 3.465 N Efemp1 n/a
6 TRCN0000351709 GCAAGGATACTGTTCTGTGTT pLKO_005 1873 3UTR 100% 4.950 3.465 N Efemp1 n/a
7 TRCN0000109681 GCTCTGTGTTAAGATTGACAA pLKO.1 1565 CDS 100% 4.950 3.465 N Efemp1 n/a
8 TRCN0000351791 GCTCTGTGTTAAGATTGACAA pLKO_005 1565 CDS 100% 4.950 3.465 N Efemp1 n/a
9 TRCN0000109684 TGCCAATATCAATGTGTCAAT pLKO.1 1042 CDS 100% 4.950 3.465 N Efemp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146015.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00541 pDONR223 100% 88.8% 94.5% None (many diffs) n/a
2 ccsbBroad304_00541 pLX_304 0% 88.8% 94.5% V5 (many diffs) n/a
3 TRCN0000473809 TCTCGTGATTGAAAGAGCAGATGC pLX_317 21.3% 88.8% 94.5% V5 (many diffs) n/a
Download CSV