Transcript: Mouse NM_146123.3

Mus musculus calcium channel, voltage-dependent, beta 4 subunit (Cacnb4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Cacnb4 (12298)
Length:
7928
CDS:
299..1759

Additional Resources:

NCBI RefSeq record:
NM_146123.3
NBCI Gene record:
Cacnb4 (12298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_146123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069161 CCGCCTGAAATGTTTGATGTT pLKO.1 1307 CDS 100% 4.950 6.930 N Cacnb4 n/a
2 TRCN0000069162 CGAAGTCCAAACCTGTAGCTT pLKO.1 459 CDS 100% 3.000 4.200 N Cacnb4 n/a
3 TRCN0000044090 GCGGAAGTACAAAGTGAAATT pLKO.1 1064 CDS 100% 13.200 9.240 N CACNB4 n/a
4 TRCN0000069160 CCCACAGCAATCTCTGGATTA pLKO.1 1475 CDS 100% 10.800 7.560 N Cacnb4 n/a
5 TRCN0000069159 GCCAAGGACTTTCTTCACATT pLKO.1 560 CDS 100% 4.950 3.465 N Cacnb4 n/a
6 TRCN0000069158 GCTGATTAAGTCCAGAGGAAA pLKO.1 1228 CDS 100% 4.950 2.970 N Cacnb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_146123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00202 pDONR223 100% 82.6% 88.9% None (many diffs) n/a
2 ccsbBroad304_00202 pLX_304 0% 82.6% 88.9% V5 (many diffs) n/a
3 TRCN0000476597 TATGCGGCAACACTGTTGCCTGAA pLX_317 24.4% 82.6% 88.9% V5 (many diffs) n/a
Download CSV