Transcript: Mouse NM_147153.3

Mus musculus VPS39 HOPS complex subunit (Vps39), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Vps39 (269338)
Length:
4395
CDS:
147..2807

Additional Resources:

NCBI RefSeq record:
NM_147153.3
NBCI Gene record:
Vps39 (269338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_147153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120896 GTTTGAGGTAACACTAGAGAA pLKO.1 329 CDS 100% 4.950 6.930 N Vps39 n/a
2 TRCN0000345308 GTTTGAGGTAACACTAGAGAA pLKO_005 329 CDS 100% 4.950 6.930 N Vps39 n/a
3 TRCN0000148592 CCATGTGGTTTCCCAGTTTAA pLKO.1 386 CDS 100% 13.200 9.240 N VPS39 n/a
4 TRCN0000146521 CCAGCAAACACTCAGATCAAT pLKO.1 2520 CDS 100% 5.625 3.938 N VPS39 n/a
5 TRCN0000120895 CCACGTCTTGAAGGACACAAA pLKO.1 2276 CDS 100% 4.950 3.465 N Vps39 n/a
6 TRCN0000345239 CCACGTCTTGAAGGACACAAA pLKO_005 2276 CDS 100% 4.950 3.465 N Vps39 n/a
7 TRCN0000120892 CGCTGTTATGTTGCAGACAAT pLKO.1 3000 3UTR 100% 4.950 3.465 N Vps39 n/a
8 TRCN0000120894 CGTTGGTTTCAAGAGAGACTA pLKO.1 680 CDS 100% 4.950 3.465 N Vps39 n/a
9 TRCN0000120893 GCCAGCAAACACTCAGATCAA pLKO.1 2519 CDS 100% 4.950 3.465 N Vps39 n/a
10 TRCN0000345310 GCCAGCAAACACTCAGATCAA pLKO_005 2519 CDS 100% 4.950 3.465 N Vps39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147153.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02753 pDONR223 100% 89.9% 96% None (many diffs) n/a
2 ccsbBroad304_02753 pLX_304 0% 89.9% 96% V5 (many diffs) n/a
3 TRCN0000472102 CAATCTACATGATTAGCGGGCTCA pLX_317 19.4% 89.9% 96% V5 (many diffs) n/a
4 ccsbBroadEn_11723 pDONR223 100% 73.7% 78.4% None (many diffs) n/a
5 ccsbBroad304_11723 pLX_304 0% 73.7% 78.4% V5 (many diffs) n/a
6 TRCN0000480144 GCATTGTCAAAAATGCGGCATATC pLX_317 17.6% 73.7% 78.4% V5 (many diffs) n/a
Download CSV