Transcript: Human NM_147686.4

Homo sapiens TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
TRAF3IP2 (10758)
Length:
5833
CDS:
112..1809

Additional Resources:

NCBI RefSeq record:
NM_147686.4
NBCI Gene record:
TRAF3IP2 (10758)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_147686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162747 CCGTGATGATAATCGTAGCAA pLKO.1 1475 CDS 100% 3.000 4.200 N TRAF3IP2 n/a
2 TRCN0000158671 CGAGGCATTGATATCATTAAA pLKO.1 1426 CDS 100% 15.000 10.500 N TRAF3IP2 n/a
3 TRCN0000161513 GCTGAAACCAATCCCAGAATA pLKO.1 168 CDS 100% 13.200 9.240 N TRAF3IP2 n/a
4 TRCN0000158694 GCGGAAAGTCTTTATCACTTA pLKO.1 1311 CDS 100% 4.950 3.465 N TRAF3IP2 n/a
5 TRCN0000160964 GCTTCAGAACACTCATGTCTA pLKO.1 1680 CDS 100% 4.950 3.465 N TRAF3IP2 n/a
6 TRCN0000163987 CCTTAGGGATAAGACCGTGAT pLKO.1 1461 CDS 100% 4.050 2.835 N TRAF3IP2 n/a
7 TRCN0000158477 CATGGAACTATCATTACCATT pLKO.1 890 CDS 100% 4.950 2.970 N TRAF3IP2 n/a
8 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 4324 3UTR 100% 10.800 5.400 Y MRPS16 n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2499 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2499 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3504 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 3559 3UTR 100% 4.050 2.025 Y INTS7 n/a
13 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 5347 3UTR 100% 1.080 0.540 Y IGF1 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3505 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 4324 3UTR 100% 10.800 5.400 Y CD3EAP n/a
16 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3429 3UTR 100% 5.625 2.813 Y KLHL30 n/a
17 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2497 3UTR 100% 4.950 2.475 Y ERN2 n/a
18 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2497 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2497 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 3393 3UTR 100% 4.950 2.475 Y RBM48 n/a
21 TRCN0000014673 GCAGATCATTTGAGGTCAGAA pLKO.1 2535 3UTR 100% 4.950 2.475 Y ZNF14 n/a
22 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3429 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_147686.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07674 pDONR223 100% 99.9% 99.8% None 969C>A n/a
2 ccsbBroad304_07674 pLX_304 0% 99.9% 99.8% V5 969C>A n/a
3 TRCN0000477300 AGGTGTCGGCCGTTAGCTATAACC pLX_317 24.7% 99.9% 99.8% V5 969C>A n/a
Download CSV