Transcript: Mouse NM_148930.3

Mus musculus RNA binding motif protein 5 (Rbm5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rbm5 (83486)
Length:
3104
CDS:
168..2615

Additional Resources:

NCBI RefSeq record:
NM_148930.3
NBCI Gene record:
Rbm5 (83486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_148930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054663 CGAGAGCGATATTCGAGAAAT pLKO.1 497 CDS 100% 13.200 18.480 N Rbm5 n/a
2 TRCN0000287632 CGAGAGCGATATTCGAGAAAT pLKO_005 497 CDS 100% 13.200 18.480 N Rbm5 n/a
3 TRCN0000054667 CGGTCTGAAGATGGCTATCAT pLKO.1 378 CDS 100% 5.625 4.500 N Rbm5 n/a
4 TRCN0000295102 CTAAGGTGTATATAGTGTAAA pLKO_005 2832 3UTR 100% 13.200 9.240 N Rbm5 n/a
5 TRCN0000295101 TGAGGCTCAAGTCCGACTAAA pLKO_005 2486 CDS 100% 13.200 9.240 N Rbm5 n/a
6 TRCN0000369392 TGACCGTGATGAGCGTGAATC pLKO_005 236 CDS 100% 10.800 7.560 N RBM5 n/a
7 TRCN0000054665 CCACAGTAACATTGGCAACAA pLKO.1 2393 CDS 100% 4.950 3.465 N Rbm5 n/a
8 TRCN0000287688 CCACAGTAACATTGGCAACAA pLKO_005 2393 CDS 100% 4.950 3.465 N Rbm5 n/a
9 TRCN0000074876 GCAGACAAGTTTGACTCTGAA pLKO.1 783 CDS 100% 4.950 3.465 N RBM5 n/a
10 TRCN0000054666 GTCAATAACATTCGCCTCATA pLKO.1 942 CDS 100% 4.950 3.465 N Rbm5 n/a
11 TRCN0000054664 GCAGCAGAAAGACGAGAGAAA pLKO.1 2280 CDS 100% 4.950 2.970 N Rbm5 n/a
12 TRCN0000287687 GCAGCAGAAAGACGAGAGAAA pLKO_005 2280 CDS 100% 4.950 2.970 N Rbm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_148930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11465 pDONR223 100% 61.7% 65.2% None (many diffs) n/a
2 ccsbBroad304_11465 pLX_304 0% 61.7% 65.2% V5 (many diffs) n/a
3 TRCN0000466364 TTAGGTTTCCAGCGTTGTGTGGTT pLX_317 18.9% 61.7% 65.2% V5 (many diffs) n/a
Download CSV