Transcript: Human NM_152525.6

Homo sapiens C2 calcium dependent domain containing 6 (C2CD6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
C2CD6 (151254)
Length:
2111
CDS:
49..1920

Additional Resources:

NCBI RefSeq record:
NM_152525.6
NBCI Gene record:
C2CD6 (151254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152525.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128530 CCGGATATCATGCACATTAAA pLKO.1 160 CDS 100% 15.000 21.000 N C2CD6 n/a
2 TRCN0000415846 GTTCGCTCATTTGTGATATTA pLKO_005 1926 3UTR 100% 15.000 21.000 N C2CD6 n/a
3 TRCN0000428523 TATACTGCTCCGGAGGTTAAC pLKO_005 1765 CDS 100% 10.800 15.120 N C2CD6 n/a
4 TRCN0000127667 CACCTTTAGGTGAACGTCAAT pLKO.1 1427 CDS 100% 4.950 3.465 N C2CD6 n/a
5 TRCN0000127570 CCAGACCTGAATGTTACTGTT pLKO.1 928 CDS 100% 4.950 3.465 N C2CD6 n/a
6 TRCN0000128393 GCCTAAGATCAGTTTACAACA pLKO.1 411 CDS 100% 4.950 3.465 N C2CD6 n/a
7 TRCN0000131188 GCTATTGCAGAGGAATCCCTA pLKO.1 132 CDS 100% 2.640 1.848 N C2CD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152525.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09680 pDONR223 100% 99.8% 99.8% None 291G>A;1128T>A n/a
2 ccsbBroad304_09680 pLX_304 0% 99.8% 99.8% V5 291G>A;1128T>A n/a
3 TRCN0000474510 GCCAGGTTCCAGAACCGCACGAGC pLX_317 30.1% 99.8% 99.8% V5 291G>A;1128T>A n/a
Download CSV