Transcript: Human NM_152531.5

Homo sapiens xyloside xylosyltransferase 1 (XXYLT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
XXYLT1 (152002)
Length:
2714
CDS:
102..1283

Additional Resources:

NCBI RefSeq record:
NM_152531.5
NBCI Gene record:
XXYLT1 (152002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152531.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158293 CGAGGTGCTTAACCTTCACTT pLKO.1 503 CDS 100% 4.950 6.930 N XXYLT1 n/a
2 TRCN0000156726 GCAGGGAAGTCCTGTGATTAA pLKO.1 1385 3UTR 100% 13.200 9.240 N XXYLT1 n/a
3 TRCN0000158040 CCAGGACTTCTTCACCATGAT pLKO.1 1091 CDS 100% 4.950 3.465 N XXYLT1 n/a
4 TRCN0000152157 CCTGAAGTTTAAGACCAACAT pLKO.1 785 CDS 100% 4.950 3.465 N XXYLT1 n/a
5 TRCN0000152494 CTTCAAGTGCAAGGTCATCTT pLKO.1 593 CDS 100% 4.950 3.465 N XXYLT1 n/a
6 TRCN0000156626 GCCAGTTTACAGGCACACATT pLKO.1 875 CDS 100% 4.950 3.465 N XXYLT1 n/a
7 TRCN0000157202 GCTTGTATCTCCCAGCTACAT pLKO.1 1942 3UTR 100% 4.950 3.465 N XXYLT1 n/a
8 TRCN0000094003 CCTGCTGATGATGTTCACCAA pLKO.1 401 CDS 100% 2.640 1.848 N Xxylt1 n/a
9 TRCN0000156328 CCTGCTGATGATGTTCACCAA pLKO.1 401 CDS 100% 2.640 1.848 N XXYLT1 n/a
10 TRCN0000156813 GAACCTACTACAGTGACTCCA pLKO.1 691 CDS 100% 2.640 1.848 N XXYLT1 n/a
11 TRCN0000157398 GCAATTCCCAAGTGTGACCAT pLKO.1 2429 3UTR 100% 2.640 1.848 N XXYLT1 n/a
12 TRCN0000153291 GAATTTGACAGTTTCCTGCCA pLKO.1 822 CDS 100% 0.660 0.462 N XXYLT1 n/a
13 TRCN0000158323 CTTGGGAACCTACTACAGTGA pLKO.1 686 CDS 100% 2.640 1.584 N XXYLT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152531.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13283 pDONR223 100% 96.6% 96.6% None 1_39del n/a
2 ccsbBroad304_13283 pLX_304 0% 96.6% 96.6% V5 1_39del n/a
3 TRCN0000477318 CCGTACAGCATCACTATAATTTTG pLX_317 34.2% 96.6% 96.6% V5 1_39del n/a
Download CSV