Transcript: Human NM_152565.1

Homo sapiens ATPase H+ transporting V0 subunit d2 (ATP6V0D2), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ATP6V0D2 (245972)
Length:
2370
CDS:
70..1122

Additional Resources:

NCBI RefSeq record:
NM_152565.1
NBCI Gene record:
ATP6V0D2 (245972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420601 TTACGAGCGTGAGGTACAAAT pLKO_005 948 CDS 100% 13.200 18.480 N ATP6V0D2 n/a
2 TRCN0000043518 GCTACGCAATAAACTATACAA pLKO.1 609 CDS 100% 5.625 7.875 N ATP6V0D2 n/a
3 TRCN0000043521 CACCTATATGACGTGCAGTTA pLKO.1 360 CDS 100% 4.950 6.930 N ATP6V0D2 n/a
4 TRCN0000419793 ACCTTGAGGCATTCTATAAAT pLKO_005 635 CDS 100% 15.000 10.500 N ATP6V0D2 n/a
5 TRCN0000427557 ATATCTTCATGAGTTGCAAAT pLKO_005 1234 3UTR 100% 10.800 7.560 N ATP6V0D2 n/a
6 TRCN0000043520 GCAGAAGTTATGTGTCCCATT pLKO.1 682 CDS 100% 4.050 2.835 N ATP6V0D2 n/a
7 TRCN0000043522 GCATATGTAAAGCTGAAGGAA pLKO.1 1015 CDS 100% 0.000 0.000 N ATP6V0D2 n/a
8 TRCN0000043519 CCAGACTACTGATTATGGTAA pLKO.1 216 CDS 100% 4.950 2.970 N ATP6V0D2 n/a
9 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1758 3UTR 100% 1.080 0.540 Y GPR83 n/a
10 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1758 3UTR 100% 1.080 0.540 Y MYORG n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2170 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2170 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05281 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05281 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475639 TTAGACGCAAGAACTCCGTTCGCC pLX_317 29.3% 100% 100% V5 n/a
Download CSV