Transcript: Human NM_152685.3

Homo sapiens solute carrier family 23 member 1 (SLC23A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SLC23A1 (9963)
Length:
2378
CDS:
98..1906

Additional Resources:

NCBI RefSeq record:
NM_152685.3
NBCI Gene record:
SLC23A1 (9963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416781 AGAGACTTGTACCAATGTTAT pLKO_005 2111 3UTR 100% 13.200 18.480 N SLC23A1 n/a
2 TRCN0000428605 CATTGAGTCCATCGGAGATTA pLKO_005 1105 CDS 100% 13.200 18.480 N SLC23A1 n/a
3 TRCN0000038237 GCCATCAATACAGGCATTCTT pLKO.1 1550 CDS 100% 5.625 7.875 N SLC23A1 n/a
4 TRCN0000038236 GCACATGGTTAGTCAGCTCAT pLKO.1 325 CDS 100% 4.050 5.670 N SLC23A1 n/a
5 TRCN0000038234 CGTGGTGACATCATGGCTATT pLKO.1 986 CDS 100% 10.800 8.640 N SLC23A1 n/a
6 TRCN0000038235 CGTGGTCTGATACAGTGGAAA pLKO.1 1673 CDS 100% 4.950 3.960 N SLC23A1 n/a
7 TRCN0000424062 AGGAAAGGAAGCATGGTATAT pLKO_005 1919 3UTR 100% 13.200 9.240 N SLC23A1 n/a
8 TRCN0000038238 CATTCCTATCTGCCCAGTCTT pLKO.1 1792 CDS 100% 4.950 3.465 N SLC23A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152685.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11438 pDONR223 100% 43% 43% None 270_1298del n/a
2 ccsbBroad304_11438 pLX_304 0% 43% 43% V5 270_1298del n/a
3 TRCN0000474619 TGAACAGTTAGGAGAACGGCCTGG pLX_317 67.6% 43% 43% V5 270_1298del n/a
Download CSV