Transcript: Human NM_152688.4

Homo sapiens KH RNA binding domain containing, signal transduction associated 2 (KHDRBS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
KHDRBS2 (202559)
Length:
2329
CDS:
278..1327

Additional Resources:

NCBI RefSeq record:
NM_152688.4
NBCI Gene record:
KHDRBS2 (202559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152688.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429734 TGTACTGTTGGCGTGACATTG pLKO_005 1488 3UTR 100% 10.800 8.640 N KHDRBS2 n/a
2 TRCN0000427029 TTAGCAAGCATAGTCTATAAA pLKO_005 1547 3UTR 100% 15.000 10.500 N KHDRBS2 n/a
3 TRCN0000418509 GAGTGATGAGCTTCATGTATT pLKO_005 658 CDS 100% 13.200 9.240 N KHDRBS2 n/a
4 TRCN0000422583 AGCTAAGGAAGAAGAACTAAG pLKO_005 607 CDS 100% 10.800 7.560 N KHDRBS2 n/a
5 TRCN0000016895 CAGACCTATGAGACTTATGAT pLKO.1 1124 CDS 100% 5.625 3.938 N KHDRBS2 n/a
6 TRCN0000016894 CCAGCCCATGAAGCTTATGAA pLKO.1 1061 CDS 100% 5.625 3.938 N KHDRBS2 n/a
7 TRCN0000016896 GCTCTCAGAAAGAGTACTGAT pLKO.1 454 CDS 100% 4.950 3.465 N KHDRBS2 n/a
8 TRCN0000016897 CGTCAGGAACAACTACGTGAA pLKO.1 779 CDS 100% 4.050 2.835 N KHDRBS2 n/a
9 TRCN0000016893 CCTGACTACAATGATGAAATT pLKO.1 758 CDS 100% 13.200 7.920 N KHDRBS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152688.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09825 pDONR223 100% 99.8% 99.7% None 876T>C;976C>A n/a
2 ccsbBroad304_09825 pLX_304 0% 99.8% 99.7% V5 876T>C;976C>A n/a
3 TRCN0000468185 TTTTAGCTTTGTCAGTAAAATCGA pLX_317 39.6% 99.8% 99.7% V5 876T>C;976C>A n/a
Download CSV