Transcript: Human NM_152745.3

Homo sapiens neurexophilin 1 (NXPH1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NXPH1 (30010)
Length:
3265
CDS:
1258..2073

Additional Resources:

NCBI RefSeq record:
NM_152745.3
NBCI Gene record:
NXPH1 (30010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152745.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162398 CAACTGGTCAAGGGAATGTAT pLKO.1 1727 CDS 100% 5.625 7.875 N NXPH1 n/a
2 TRCN0000161250 GCACAACAAACCGTGATTGAT pLKO.1 1792 CDS 100% 5.625 7.875 N NXPH1 n/a
3 TRCN0000161759 CCAATTTAACGAACGGTGGAA pLKO.1 1322 CDS 100% 2.640 3.696 N NXPH1 n/a
4 TRCN0000163934 GCCAATTTAACGAACGGTGGA pLKO.1 1321 CDS 100% 2.160 3.024 N NXPH1 n/a
5 TRCN0000162012 GAAGCAGCAAATCCACACTAA pLKO.1 1364 CDS 100% 4.950 3.960 N NXPH1 n/a
6 TRCN0000161189 GCCCTTTAAGGTGATCTGTAT pLKO.1 1956 CDS 100% 4.950 3.960 N NXPH1 n/a
7 TRCN0000164220 CAGGAGCAAACCCAAAGTCAT pLKO.1 1915 CDS 100% 4.950 3.465 N NXPH1 n/a
8 TRCN0000158594 CCTGAGGAATTAAAGGTCATA pLKO.1 2100 3UTR 100% 4.950 3.465 N NXPH1 n/a
9 TRCN0000159209 GAATTTGACTTGGCACAACAA pLKO.1 1780 CDS 100% 4.950 3.465 N NXPH1 n/a
10 TRCN0000158978 GCTTTCATTGTCTGACTCATA pLKO.1 2386 3UTR 100% 4.950 3.465 N NXPH1 n/a
11 TRCN0000161952 GCCTGAGGAATTAAAGGTCAT pLKO.1 2099 3UTR 100% 4.050 2.835 N NXPH1 n/a
12 TRCN0000158626 CAGAACTTCTGAAATCAGGAA pLKO.1 1346 CDS 100% 2.640 1.848 N NXPH1 n/a
13 TRCN0000164141 CCTGAAGACATGCTCTCACAT pLKO.1 2298 3UTR 100% 4.950 2.970 N NXPH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152745.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03130 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03130 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472312 TTCTAGCCAACCGTTCTGCATAGT pLX_317 48.6% 100% 100% V5 n/a
Download CSV