Transcript: Human NM_152755.2

Homo sapiens canopy FGF signaling regulator 4 (CNPY4), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CNPY4 (245812)
Length:
1478
CDS:
112..858

Additional Resources:

NCBI RefSeq record:
NM_152755.2
NBCI Gene record:
CNPY4 (245812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159014 GAAGAGGCCTTAGAGAATTTA pLKO.1 370 CDS 100% 15.000 10.500 N CNPY4 n/a
2 TRCN0000422882 ACTTGACCGAGAAGATCTTTG pLKO_005 837 CDS 100% 10.800 7.560 N CNPY4 n/a
3 TRCN0000164023 CGGACATTCTCTGCGATCTAT pLKO.1 1253 3UTR 100% 5.625 3.938 N CNPY4 n/a
4 TRCN0000136783 CATTGTGGGAGACTGGTACTT pLKO.1 606 CDS 100% 4.950 3.465 N CNPY4 n/a
5 TRCN0000135317 CTTACAGCGTTTCAGAGACAA pLKO.1 344 CDS 100% 4.950 3.465 N CNPY4 n/a
6 TRCN0000160862 GCTCCTAGAGATGAACTCTAT pLKO.1 1063 3UTR 100% 0.495 0.347 N CNPY4 n/a
7 TRCN0000164447 CAAGAAGCAGTGTGAGACCAT pLKO.1 567 CDS 100% 2.640 1.584 N CNPY4 n/a
8 TRCN0000163917 CCAGCAAATGCGAAGTGTGTA pLKO.1 215 CDS 100% 4.950 2.475 Y CNPY4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152755.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472373 GCACGTCAACGCCGATAGGGTACC pLX_317 53.6% 99.5% 99.5% V5 656_658delAGG n/a
2 ccsbBroadEn_14445 pDONR223 100% 99.5% 88.3% None 656_658delAGGinsNN n/a
3 ccsbBroad304_14445 pLX_304 0% 99.5% 88.3% V5 (not translated due to prior stop codon) 656_658delAGGinsNN n/a
4 ccsbBroadEn_16133 pDONR223 0% 99.1% 99.1% None 656_661delAGGAGG n/a
Download CSV