Transcript: Human NM_152765.4

Homo sapiens vexin (VXN), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
VXN (254778)
Length:
3155
CDS:
84..707

Additional Resources:

NCBI RefSeq record:
NM_152765.4
NBCI Gene record:
VXN (254778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152765.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140616 GCACCTCTTGACCAAGAATGT pLKO.1 191 CDS 100% 4.950 6.930 N VXN n/a
2 TRCN0000121598 CACAAGAAGAAGTCTGAATAT pLKO.1 651 CDS 100% 13.200 9.240 N VXN n/a
3 TRCN0000192679 GCACAAGAAGAAGTCTGAATA pLKO.1 650 CDS 100% 13.200 9.240 N 3110035E14Rik n/a
4 TRCN0000264282 GCACAAGAAGAAGTCTGAATA pLKO_005 650 CDS 100% 13.200 9.240 N 3110035E14Rik n/a
5 TRCN0000264281 CTGTGTGGGAATCGAGCATAT pLKO_005 393 CDS 100% 10.800 7.560 N 3110035E14Rik n/a
6 TRCN0000139131 CAGCACCTCTTGACCAAGAAT pLKO.1 189 CDS 100% 5.625 3.938 N VXN n/a
7 TRCN0000140089 GAGAGGATCCAGACATCTCAA pLKO.1 518 CDS 100% 4.950 3.465 N VXN n/a
8 TRCN0000141057 CTTGACCAAGAATGTGGTGAT pLKO.1 197 CDS 100% 4.050 2.835 N VXN n/a
9 TRCN0000141604 CCAGACATCTCAAGAAGATGA pLKO.1 526 CDS 100% 0.495 0.347 N VXN n/a
10 TRCN0000145558 CAAGAAGATGACTGAAGAGTA pLKO.1 536 CDS 100% 4.950 2.970 N VXN n/a
11 TRCN0000122318 CCAGCCAGAAGAAGAGCCAAA pLKO.1 162 CDS 100% 4.050 2.430 N VXN n/a
12 TRCN0000145294 GCACTTGTAAACACAATGGTT pLKO.1 1096 3UTR 100% 3.000 1.800 N VXN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152765.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10481 pDONR223 100% 99.5% 99.5% None 1_3delATG n/a
2 ccsbBroad304_10481 pLX_304 0% 99.5% 99.5% V5 1_3delATG n/a
3 TRCN0000477900 CCCAATGTTACCCCCAAGCTGTAG pLX_317 57.2% 99.5% 99.5% V5 1_3delATG n/a
Download CSV