Transcript: Human NM_152781.4

Homo sapiens HEAT repeat containing 9 (HEATR9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
HEATR9 (256957)
Length:
1970
CDS:
150..1862

Additional Resources:

NCBI RefSeq record:
NM_152781.4
NBCI Gene record:
HEATR9 (256957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152781.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155859 CCCGTACTGCTACTTCAAGAA pLKO.1 356 CDS 100% 4.950 6.930 N HEATR9 n/a
2 TRCN0000155539 GCTCAAGTTGAAGCCTACGAT pLKO.1 1337 CDS 100% 3.000 4.200 N HEATR9 n/a
3 TRCN0000150695 GCTAGAGGAACTCACATTTAA pLKO.1 1244 CDS 100% 15.000 10.500 N HEATR9 n/a
4 TRCN0000151497 CAATGAGCAAGCTGACTATAA pLKO.1 517 CDS 100% 13.200 9.240 N HEATR9 n/a
5 TRCN0000435321 CCAATGAGCAAGCTGACTATA pLKO_005 516 CDS 100% 13.200 9.240 N HEATR9 n/a
6 TRCN0000412746 ACCCAGAAGAGTTAACTATTC pLKO_005 1654 CDS 100% 10.800 7.560 N HEATR9 n/a
7 TRCN0000428610 TACGCATCAGTGACAAGTTTG pLKO_005 673 CDS 100% 10.800 7.560 N HEATR9 n/a
8 TRCN0000151558 GAATATCCAGACAAGACCAAA pLKO.1 216 CDS 100% 4.950 3.465 N HEATR9 n/a
9 TRCN0000155265 GCACAACTGATGAACCCAGAT pLKO.1 1374 CDS 100% 4.050 2.835 N HEATR9 n/a
10 TRCN0000154520 GCCTACGATGATGAACTTGGT pLKO.1 1349 CDS 100% 2.640 1.848 N HEATR9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152781.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09918 pDONR223 100% 99.9% 99.8% None 8A>G n/a
2 ccsbBroad304_09918 pLX_304 0% 99.9% 99.8% V5 8A>G n/a
3 TRCN0000470686 TATCTAGGGATAAAATCTACCATT pLX_317 23.2% 99.9% 99.8% V5 8A>G n/a
4 ccsbBroadEn_16136 pDONR223 0% 36.7% 33.5% None (many diffs) n/a
5 ccsbBroad304_16136 pLX_304 0% 36.7% 33.5% V5 (many diffs) n/a
6 TRCN0000465860 TTATTTGGGAGCACATGAATTCAA pLX_317 50.5% 36.7% 33.5% V5 (many diffs) n/a
Download CSV